ID: 935375235

View in Genome Browser
Species Human (GRCh38)
Location 2:102388693-102388715
Sequence ACGCACGCACACATTGGCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 152}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935375235_935375238 26 Left 935375235 2:102388693-102388715 CCCGTGCCAATGTGTGCGTGCGT 0: 1
1: 0
2: 0
3: 17
4: 152
Right 935375238 2:102388742-102388764 TGACTATGCAGTCCTTTCCAAGG 0: 1
1: 0
2: 2
3: 17
4: 151

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935375235 Original CRISPR ACGCACGCACACATTGGCAC GGG (reversed) Intronic
900716245 1:4146794-4146816 ACACACGCACACATTTGGAATGG + Intergenic
900947566 1:5839898-5839920 ATGCACACACACATTCACACAGG + Intergenic
905246393 1:36617374-36617396 ACACACACACACACTTGCACAGG - Intergenic
908789927 1:67770959-67770981 ACGCACACACACATGCACACAGG - Intronic
909802226 1:79824289-79824311 ACACACACACACATTCTCACTGG + Intergenic
917672000 1:177281726-177281748 ACACACACACACACTGGCACAGG + Exonic
919649358 1:200130779-200130801 ACCCACACACACACTGCCACTGG + Intronic
1067565498 10:47333120-47333142 TCGTACGCAGGCATTGGCACTGG + Intergenic
1068008265 10:51415963-51415985 ACACACGCACACATATACACAGG + Intronic
1069992098 10:72322302-72322324 ATGCACGCACACAGAGACACAGG - Intergenic
1070041469 10:72784704-72784726 ACCCACGCACACATACGGACAGG - Intronic
1070547229 10:77462148-77462170 ACGCATGCACACAATGAAACAGG + Intronic
1072610419 10:97014068-97014090 ACAGACGCCCCCATTGGCACAGG + Exonic
1072994197 10:100229025-100229047 ACGGACGCACACATTCCCAAAGG + Intronic
1073135790 10:101219340-101219362 ACGGGCGCACACACCGGCACAGG + Intergenic
1074161203 10:110837741-110837763 AAGCACGCAGTCATTGGCAAGGG + Exonic
1075297744 10:121292969-121292991 ATGCTCACACACATAGGCACAGG + Intergenic
1075654788 10:124153639-124153661 ACCCACTCACACATAGGCACAGG + Intergenic
1075654835 10:124154231-124154253 ACACACACACACATAAGCACAGG + Intergenic
1076042342 10:127261042-127261064 ATGCACACACACATGAGCACGGG - Intronic
1076499499 10:130925561-130925583 TTGCACTCACACAATGGCACAGG - Intergenic
1077170912 11:1165340-1165362 ACGCAGGCACACTTTGACACAGG - Exonic
1077236694 11:1485276-1485298 ACACAAGCACACACTGGCACAGG + Intronic
1081861434 11:46335449-46335471 ACACACGCACACAGCGGCAAGGG + Intronic
1084315523 11:68343264-68343286 ACACACGCACAGAGTGGGACTGG - Intronic
1085908585 11:80794486-80794508 ATGCACACCCACATTGGCAAGGG + Intergenic
1090455942 11:126849828-126849850 ACGCACGTTCACCATGGCACAGG + Intronic
1090924295 11:131236066-131236088 ACACATGCACACATGTGCACAGG - Intergenic
1091299727 11:134499895-134499917 ACACACGTACACATGTGCACGGG + Intergenic
1091327843 11:134704716-134704738 ACGCACACACACACAGACACAGG + Intergenic
1091444929 12:539287-539309 ACACATGAACAGATTGGCACTGG - Intronic
1091763912 12:3105876-3105898 ACACATGCACACATGGTCACGGG + Intronic
1092954920 12:13541026-13541048 ACGCTCACACACATGTGCACAGG + Exonic
1097624051 12:61978565-61978587 ATGCCCGCACACATTAGAACTGG + Intronic
1098504863 12:71237677-71237699 ACACACACACACATTTGGACAGG + Intronic
1104424512 12:128664140-128664162 AGGCACACACACATGCGCACAGG + Intronic
1106735755 13:32586668-32586690 ACACACGCACACAGCGGCAGTGG - Intronic
1110712311 13:78663869-78663891 ACGCACACACACAGTGAGACTGG + Intergenic
1112495795 13:99903422-99903444 ACGCACACACACATGCACACAGG + Intergenic
1113045507 13:106150651-106150673 ACACACTCACACATTCACACAGG + Intergenic
1113328393 13:109305913-109305935 ACACACACACACACAGGCACAGG - Intergenic
1118234818 14:63992735-63992757 AGGCATGCACACATGGGCAGTGG + Intronic
1118289018 14:64503844-64503866 ACGCACGCACACCCCGGCCCTGG - Exonic
1120009733 14:79399979-79400001 ACTCACACACACATATGCACAGG - Intronic
1123906236 15:24924351-24924373 ACACACGCAGACTTTGTCACCGG - Intronic
1125202359 15:37111101-37111123 ACGCACACACACACTGGGTCGGG - Intergenic
1125383094 15:39108290-39108312 ACACACACACACATATGCACAGG - Intergenic
1125394594 15:39233085-39233107 ACACACACACACACTGACACTGG + Intergenic
1130343328 15:83018925-83018947 ACACACGCACACATTGCTAAGGG - Intronic
1131114187 15:89784114-89784136 CTCCACGCACACATTGGCCCTGG - Intergenic
1131294787 15:91137686-91137708 ACACACACACACATTTGCACAGG + Intronic
1133551952 16:6864962-6864984 ACCCACTCCAACATTGGCACTGG - Intronic
1133817091 16:9206171-9206193 ACGCACACACACATGGGATCAGG - Intergenic
1133859422 16:9580250-9580272 ACGCGTGCACACATTGACAGTGG + Intergenic
1138088690 16:54156524-54156546 ACGCACACACACATACACACAGG + Intergenic
1142186303 16:88696328-88696350 AGCCACCTACACATTGGCACTGG - Intergenic
1144619308 17:16806650-16806672 ACACACCCACACATGTGCACAGG - Intergenic
1144701394 17:17343234-17343256 ACACACACACACATATGCACAGG - Intronic
1144893383 17:18509025-18509047 ACACACCCACACATGTGCACAGG + Intergenic
1145138843 17:20435249-20435271 ACACACCCACACATGTGCACAGG - Intergenic
1149247029 17:54721657-54721679 ACACACACACACATTCACACAGG + Intergenic
1151391701 17:73791538-73791560 ACGCACACACACAGTGGGATAGG + Intergenic
1155947686 18:31874900-31874922 ACGCACACACACAATGGCTCAGG - Intronic
1156157326 18:34318701-34318723 ACACATGCACACATGTGCACAGG + Intergenic
1157922558 18:51728245-51728267 ATGCAGGAACACTTTGGCACAGG + Intergenic
1160345095 18:78125956-78125978 ACTCAGGCACACATAGACACAGG - Intergenic
1160566462 18:79789174-79789196 ATGCACGCACACATGCACACAGG + Intergenic
1160572588 18:79828333-79828355 ACTCATGCACACACTGACACAGG - Intergenic
1164913939 19:32034804-32034826 ACACACACACACACAGGCACAGG + Intergenic
1168145408 19:54417354-54417376 ATGCACACACACATATGCACAGG + Intronic
1168313189 19:55471975-55471997 AGGCACTCACACAAGGGCACGGG + Intergenic
925197111 2:1934756-1934778 ACACACACACACACAGGCACAGG + Intronic
925353547 2:3220328-3220350 ACACACGCACACAATGGCCATGG + Intronic
925353571 2:3220740-3220762 ACACACGCACACAATGGCCGAGG + Intronic
925353577 2:3220794-3220816 ACACACGCACACAATGGCCGAGG + Intronic
925353598 2:3221060-3221082 ACACACGCACACAATGGCCGAGG + Intronic
925353603 2:3221114-3221136 ACACACGCACACAATGGCCGAGG + Intronic
925353608 2:3221168-3221190 ACACACGCACACAATGGCCGAGG + Intronic
925353613 2:3221222-3221244 ACACACGCACACAATGGCCGAGG + Intronic
925353618 2:3221276-3221298 ACACACGCACACAATGGCCGAGG + Intronic
925353623 2:3221330-3221352 ACACACGCACACAATGGCCGAGG + Intronic
925353628 2:3221384-3221406 ACACACGCACACAATGGCCGAGG + Intronic
925353637 2:3221492-3221514 ACACACGCACACAATGGCCGAGG + Intronic
925353642 2:3221546-3221568 ACACACGCACACAATGGCCGAGG + Intronic
925353651 2:3221654-3221676 ACACACGCACACAATGGCCGAGG + Intronic
927965345 2:27264504-27264526 CCGCCCGCACACCTTGGCACGGG - Intronic
931049146 2:58390495-58390517 ATGCTCACACACATTGTCACTGG + Intergenic
935375235 2:102388693-102388715 ACGCACGCACACATTGGCACGGG - Intronic
936069146 2:109353772-109353794 ACGCATGCACACACGGGCAGGGG - Intronic
937154399 2:119708677-119708699 ACACACACACACAGTCGCACTGG + Intergenic
937159651 2:119747894-119747916 ACACACACACACATGGACACAGG + Intergenic
939990218 2:148871151-148871173 ACACACACACACTTTAGCACAGG - Intergenic
940361866 2:152804797-152804819 GTGCAGGCACACAGTGGCACGGG - Intergenic
940474343 2:154142813-154142835 ACACACACACACATATGCACAGG - Intronic
943071959 2:183152143-183152165 ACACACACACACAATGTCACAGG + Intronic
945197256 2:207248507-207248529 ACACAAGCACACATTAGCATAGG - Intergenic
945761409 2:213920406-213920428 ATGCACACACACGTTGGCATGGG + Intronic
947361832 2:229353243-229353265 ATGCACGCACACACAGGCACAGG + Intergenic
948639432 2:239365582-239365604 ACACACACACACACTTGCACAGG + Intronic
949059836 2:241950453-241950475 ACACACGCACACACAGACACGGG - Intergenic
1172446835 20:34997630-34997652 AGGCACGGACACCTTGGCGCGGG - Exonic
1173006491 20:39143263-39143285 AAGCACACACAGCTTGGCACTGG + Intergenic
1174776165 20:53345166-53345188 ACACATCCACACTTTGGCACAGG - Intronic
1175728113 20:61333223-61333245 ACGCATGCACACATATGCACAGG + Intronic
1175972297 20:62692787-62692809 GTGCACGCACACATGGGCATGGG - Intergenic
1176050687 20:63117966-63117988 ACGCAGGCACACATGCACACAGG + Intergenic
1176229004 20:64021399-64021421 ACACACGCACACACAGACACAGG - Intronic
1176229029 20:64021669-64021691 ACACACGCACACACAGACACGGG - Intronic
1176382771 21:6121355-6121377 ACACACCTGCACATTGGCACCGG + Exonic
1177216515 21:18136602-18136624 ACGCACACACACACTCCCACAGG - Intronic
1179094667 21:38302070-38302092 ACACACGCACACACTTGCACAGG + Exonic
1179740698 21:43416884-43416906 ACACACCTGCACATTGGCACCGG - Exonic
1181010325 22:20036564-20036586 ACCCATGCACTCATTGGCACTGG - Intronic
1181048850 22:20229244-20229266 ATGCACCCACACATGTGCACAGG - Intergenic
1181322741 22:22021186-22021208 ACACACACACACACTGTCACAGG + Intergenic
1183369890 22:37426605-37426627 ACGCACGCACACACACACACTGG + Intronic
1185091197 22:48774954-48774976 ACGCACACACAAATGAGCACAGG - Intronic
950638311 3:14331779-14331801 ACGAACGCACACATTAGCCCAGG + Intergenic
955338042 3:58103309-58103331 ACGTACGCACACATACGCAGAGG - Intronic
955751810 3:62191110-62191132 ACACACGCACACATGTGCATGGG - Intronic
957430302 3:80096269-80096291 ACACACACACACACAGGCACAGG - Intergenic
958883517 3:99699999-99700021 ACTCATGCGCACATTAGCACTGG - Intronic
959462493 3:106644053-106644075 ACGCAAGCCCACAGTGGCAGAGG - Intergenic
959672613 3:108996253-108996275 ACGCACGCGCACATGTGCACAGG - Intronic
961574380 3:127822968-127822990 ACACACGCACACATGGGTAGCGG + Intronic
964596418 3:158437334-158437356 TAGTAAGCACACATTGGCACTGG + Intronic
966173162 3:177105775-177105797 ACACACCCACACACTGACACGGG - Intronic
968653398 4:1768723-1768745 ACGCAGGCACACACAGGCACAGG + Intergenic
969613448 4:8239365-8239387 GCACACGCACACACAGGCACAGG + Intronic
985748821 5:1662818-1662840 ACGCAGGCACACACAGACACAGG - Intergenic
985848147 5:2369521-2369543 ACGCATGCACACACAGACACAGG + Intergenic
986015323 5:3752423-3752445 ACGCACACGCACACAGGCACAGG + Intergenic
990008453 5:50968570-50968592 ACGCACGCACACACACACACCGG + Intergenic
990845786 5:60137004-60137026 ACGCATGGACACATTGGGAGTGG - Intronic
992041155 5:72834474-72834496 ACGAACACACACATTGGCCTAGG - Intronic
993022361 5:82606265-82606287 AGGGAGGCACACAGTGGCACTGG - Intergenic
1002106141 5:176880229-176880251 ATGCACGCACACACTGGGCCTGG + Exonic
1003968459 6:11276372-11276394 ACGCACACACACACGTGCACAGG - Intronic
1008408477 6:51145345-51145367 ACACACACACACATTTGCATAGG - Intergenic
1010235575 6:73572509-73572531 GCGCACGCACGCACTGGGACTGG - Intergenic
1011792246 6:90911005-90911027 ACGCGCGCACACATTTGCCTAGG - Intergenic
1013836703 6:114342821-114342843 GCGCCCGCACAGCTTGGCACCGG - Exonic
1016340993 6:143061101-143061123 ACACACGCACACACAGGCACGGG - Intronic
1019138283 6:169925985-169926007 ACACACGTACACATTCTCACAGG + Intergenic
1019261674 7:85426-85448 ACACACTCACACACTGACACAGG - Intergenic
1024698593 7:51882961-51882983 ACACACTCACATTTTGGCACTGG + Intergenic
1026639390 7:72110878-72110900 ACCCACGGAGACATTGGAACAGG + Intronic
1029987196 7:104933372-104933394 ACACACACACACATTCACACAGG + Intergenic
1030931975 7:115535877-115535899 ACACAAGCACACAGTGGGACTGG - Intergenic
1032470700 7:132176341-132176363 ATGCACACACACATTGGTGCAGG - Intronic
1035112944 7:156499303-156499325 ATGCAAACACACATGGGCACAGG + Intergenic
1035333309 7:158110522-158110544 AGGCTCCCACACATTGGCATAGG + Intronic
1035431653 7:158828049-158828071 ACACACACACACATTCACACTGG + Intronic
1036444993 8:8813530-8813552 AGACACACACACATTGGCTCAGG - Intronic
1039517000 8:38142482-38142504 ACACACACACACATTGGGATGGG - Intronic
1048779058 8:137981220-137981242 ACATACACACACATAGGCACAGG + Intergenic
1050857696 9:10381608-10381630 ACAAAAGCACACATTAGCACTGG + Intronic
1051719761 9:20024357-20024379 ACACACACACACATAGGCAGTGG + Intergenic
1056464317 9:86838938-86838960 CCGCACGCACACGTAGGCACAGG - Intergenic
1056826962 9:89883080-89883102 ACACACGCACACCTTCTCACAGG + Intergenic
1057995741 9:99820560-99820582 ACACACACACAAATTGGGACAGG + Intergenic
1061292039 9:129655909-129655931 ACGCAAGCCCACAGTGGGACCGG + Intergenic
1062368879 9:136226353-136226375 ACACACGCACACACAGGCACAGG - Intronic
1062522256 9:136963080-136963102 ACACACGCACACACGTGCACAGG + Intergenic
1062562402 9:137147408-137147430 ACACACGCACACACGTGCACAGG + Intronic
1190652174 X:52577956-52577978 ACTCACGCCCAGATTGGCATTGG - Intergenic
1194346658 X:92773632-92773654 ATGCATGCACACACTGGCAAAGG - Intergenic
1199373065 X:147074268-147074290 ACAAACGCACACATTAGCCCAGG + Intergenic
1199561004 X:149162114-149162136 GTGCACACACACATTTGCACTGG - Intergenic
1200654992 Y:5890276-5890298 ATGCATGCACACACTGGCAAAGG - Intergenic