ID: 935377963

View in Genome Browser
Species Human (GRCh38)
Location 2:102419985-102420007
Sequence TGATGTACTCTGCATTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 2, 3: 16, 4: 187}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935377960_935377963 -7 Left 935377960 2:102419969-102419991 CCCAGTGCTCAATAAATGATGTA 0: 1
1: 1
2: 1
3: 30
4: 176
Right 935377963 2:102419985-102420007 TGATGTACTCTGCATTTTGGTGG 0: 1
1: 0
2: 2
3: 16
4: 187
935377961_935377963 -8 Left 935377961 2:102419970-102419992 CCAGTGCTCAATAAATGATGTAC 0: 1
1: 0
2: 1
3: 7
4: 115
Right 935377963 2:102419985-102420007 TGATGTACTCTGCATTTTGGTGG 0: 1
1: 0
2: 2
3: 16
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935377963 Original CRISPR TGATGTACTCTGCATTTTGG TGG Intronic
905019264 1:34797162-34797184 TGATGTTATTTGCATTTTAGAGG - Intronic
906096953 1:43230393-43230415 TGATGTAATTTGCATCTTAGAGG - Intronic
906682217 1:47736062-47736084 TGATGTTTTCTTCATCTTGGAGG - Intergenic
907317767 1:53583459-53583481 TGCAGGACTCTGCATTCTGGGGG - Intronic
915645216 1:157265752-157265774 TGATGTCCTTTGTATTTTTGTGG - Intergenic
915665732 1:157442528-157442550 AGTTGTACTCTCTATTTTGGGGG + Intergenic
915842688 1:159228657-159228679 TTGAATACTCTGCATTTTGGAGG + Intergenic
918146817 1:181763893-181763915 AGATGTCCTCTGCATTTTCAGGG + Intronic
918366073 1:183809075-183809097 TGATAAACTCCCCATTTTGGAGG + Intronic
923063894 1:230500746-230500768 TGATGTCCTTTGGATTTTGGTGG + Intergenic
1065691774 10:28341411-28341433 TGAGGTACACTGTATTTTGGGGG + Intergenic
1066471719 10:35704305-35704327 TAATTTACTCTGGATTTTGTAGG - Intergenic
1068760751 10:60706230-60706252 TGATGCCCTTTGCATTTAGGTGG - Intronic
1069325381 10:67225824-67225846 TGAGGTAGTGTGCTTTTTGGGGG - Intronic
1070128040 10:73637651-73637673 GGATGTTGACTGCATTTTGGAGG + Intronic
1071254502 10:83858213-83858235 ATATGTACTCTGCCATTTGGGGG + Intergenic
1071273802 10:84034165-84034187 TGATTTTCTCTGCTTTTGGGGGG + Intergenic
1071450467 10:85787983-85788005 TGATGTGCTCAGTATTTTGCAGG - Intronic
1072989288 10:100175507-100175529 TGCTTTCCTCTGCATTTTGCTGG + Intronic
1073758411 10:106605619-106605641 TTATCTGCACTGCATTTTGGTGG - Intronic
1073775162 10:106777033-106777055 TTATGCACTTTCCATTTTGGGGG + Intronic
1074719877 10:116255203-116255225 TTATGTTCCATGCATTTTGGTGG - Intronic
1074905915 10:117863520-117863542 TGCTGTGCTGGGCATTTTGGAGG - Intergenic
1076111584 10:127863767-127863789 GGAAGTTTTCTGCATTTTGGGGG - Intergenic
1078090372 11:8261325-8261347 TGAGGTACACTGCAATTTGGAGG + Intronic
1078559816 11:12361707-12361729 TGATGTTTTCTGCATTCTGGAGG + Intergenic
1078696326 11:13635752-13635774 TGTGGTATTCTGGATTTTGGGGG + Intergenic
1079048107 11:17127215-17127237 TTTTGTTCTCTACATTTTGGTGG - Intronic
1079277735 11:19057411-19057433 TGAATTTCTCTGCATCTTGGAGG + Intronic
1081849041 11:46262139-46262161 TGATCTACTCTGCTTTTGAGGGG - Intergenic
1085026588 11:73240031-73240053 TGATGCACTGTGCAACTTGGGGG + Intergenic
1087808887 11:102588680-102588702 TGATGCTCTCTGGATTTTTGTGG + Intronic
1088625497 11:111727492-111727514 TGGGGTGCTCTGCATTTTGATGG + Exonic
1089907684 11:122059855-122059877 TTATTTTCTCTTCATTTTGGAGG - Intergenic
1090146913 11:124334578-124334600 TGATTTCATCTGCATTTTGAGGG + Intergenic
1092796626 12:12116580-12116602 TGCTGAACTGTCCATTTTGGTGG - Exonic
1092896800 12:13019932-13019954 AGATGGAATCTGCATTTTGAAGG + Intergenic
1095313558 12:40729937-40729959 TACTGTACTATGCATTTTTGGGG + Intronic
1097502295 12:60419765-60419787 TTATTTACTCACCATTTTGGAGG + Intergenic
1098127453 12:67314518-67314540 TTATGTACTATGCATTTCTGTGG + Exonic
1098435661 12:70466145-70466167 TGATGTCCTTTGGATTTAGGTGG - Intergenic
1100017651 12:90030901-90030923 TGCTCCACTCTGCATTGTGGGGG + Intergenic
1101101263 12:101395601-101395623 TGATGTAGTCTTCATTTCAGGGG + Exonic
1104659457 12:130600254-130600276 TGATGCCCTTTGGATTTTGGTGG - Intronic
1106283127 13:28295407-28295429 TTATTTCCTCTGTATTTTGGAGG + Intergenic
1106767959 13:32934199-32934221 TTATGTCCCATGCATTTTGGTGG + Intergenic
1107124307 13:36829752-36829774 TTATGTCCTCTGCATTTTACTGG - Intergenic
1107249183 13:38337627-38337649 TGATGTCCTGTTCTTTTTGGGGG + Intergenic
1109368604 13:61391689-61391711 TTCTGTACTCTGAATTTCGGTGG + Intergenic
1111798746 13:92957123-92957145 TCATTTCCTCTGCATTTTGTAGG - Intergenic
1113284221 13:108828847-108828869 TGATGTACCCTGCATCCTTGGGG + Intronic
1113706542 13:112436978-112437000 TGGTGTATTCTGCAGTTTTGGGG + Intergenic
1115132495 14:30070784-30070806 AGATGGATTCAGCATTTTGGGGG - Intronic
1117196726 14:53347374-53347396 TTATGTACGCTACATTTTGAGGG - Intergenic
1117861636 14:60098046-60098068 TGATGCCCTTTGGATTTTGGTGG - Intronic
1120692158 14:87604977-87604999 TTATTTATTCTGCTTTTTGGAGG - Intergenic
1121554714 14:94827771-94827793 TGATGTGCTGTGCCTTTTGTTGG + Intergenic
1123183184 14:106489088-106489110 AGATGTACCTTTCATTTTGGAGG - Intergenic
1125673783 15:41491857-41491879 GGATGTACTCTGCAGCTTGAAGG - Intergenic
1128410250 15:67389688-67389710 TAATGGACTATGCATTTTTGAGG + Intronic
1129940705 15:79494610-79494632 TGATGTCATCTGCACTGTGGAGG + Intergenic
1133886475 16:9832997-9833019 TAAAGTGCTCTGCTTTTTGGGGG + Intronic
1134158599 16:11865371-11865393 TGATGTGTTCTGCATGTTGATGG + Intergenic
1135813720 16:25612775-25612797 TGTTTTATTTTGCATTTTGGGGG + Intergenic
1137811279 16:51355144-51355166 TCATTTATTCTGTATTTTGGGGG - Intergenic
1138181831 16:54945778-54945800 TTTTGTATTTTGCATTTTGGGGG - Intergenic
1138897435 16:61224557-61224579 TGATGTATTTTGTCTTTTGGTGG + Intergenic
1139539142 16:67600873-67600895 TGATATAAACTTCATTTTGGTGG + Intronic
1142244506 16:88963476-88963498 TGATGTGCTCTGGAGTTAGGTGG - Intronic
1142865928 17:2791503-2791525 TGATGCACTGTGCATTTCTGTGG + Intronic
1143956595 17:10674904-10674926 TGATGCTCACTGCATTTTGATGG - Exonic
1146809392 17:35891153-35891175 TGTTTTCCTCTGCATGTTGGTGG + Intergenic
1149890663 17:60386770-60386792 TGATGAACTCTGGATTTTGGGGG - Intronic
1150885368 17:69079813-69079835 TGATATAGTTTGCATTTTAGTGG + Intronic
1151382838 17:73737367-73737389 TCATGTACTCTGGCTTCTGGTGG + Intergenic
1151641124 17:75394793-75394815 TGATGCAAACTGCATTTTGCAGG + Intronic
1152456830 17:80421636-80421658 AGATGTACCCTGCAAATTGGTGG - Intronic
1153966296 18:10185466-10185488 TGTTGTAAGCTGTATTTTGGAGG + Intergenic
1154099189 18:11453758-11453780 TGATTTAAGATGCATTTTGGAGG - Intergenic
1154141002 18:11824356-11824378 TGATGTAATTTGCATTTTGGGGG + Intronic
1155829798 18:30499824-30499846 TGTTGTACTTTACCTTTTGGGGG - Intergenic
1158643773 18:59225365-59225387 TGATTTATTCTGCATTTAGGAGG + Intronic
1159055176 18:63456162-63456184 GGACGTATTCTTCATTTTGGGGG + Intergenic
1159632985 18:70770789-70770811 TGATTTACTTTTCATTTTGCTGG + Intergenic
1165620929 19:37246904-37246926 GTATGTTTTCTGCATTTTGGGGG - Exonic
925782271 2:7392293-7392315 TGATGTCATCTCCAGTTTGGAGG + Intergenic
926630059 2:15128024-15128046 TGAAGTACTCTGCAGTCTGCTGG + Intergenic
926989877 2:18667171-18667193 TGTTATAGTTTGCATTTTGGGGG + Intergenic
928217686 2:29375923-29375945 TGATGTCCTTTGGATTTAGGTGG - Intronic
931611131 2:64102218-64102240 TGATCTACACTGCATTCTTGAGG - Intronic
932090455 2:68801324-68801346 TGCTGTCCTCTACATGTTGGAGG - Intronic
932913775 2:75833440-75833462 TGAGATACTCAGCTTTTTGGCGG - Intergenic
933246139 2:79976816-79976838 TGCTGTTCTCTGCATTATCGTGG - Intronic
935377963 2:102419985-102420007 TGATGTACTCTGCATTTTGGTGG + Intronic
937096892 2:119241437-119241459 TGTTGCAGACTGCATTTTGGTGG + Intronic
939002893 2:136756699-136756721 TGATCCCCTCTTCATTTTGGTGG + Intergenic
939887658 2:147698711-147698733 AGATGTACTCTGAAATTTGTAGG - Intergenic
941350578 2:164428573-164428595 TGAAGTACTCCGCATTTTTAAGG - Intergenic
941631518 2:167890496-167890518 TGAGGTAGTGTGAATTTTGGGGG + Intergenic
942914483 2:181286804-181286826 TGATGAACTCTGCATGTAGGAGG - Intergenic
943827285 2:192412680-192412702 TTATTTACACTACATTTTGGGGG - Intergenic
945999148 2:216466145-216466167 TGGTGGACTCTGAATTTTGCAGG - Intronic
948009671 2:234641390-234641412 GGATGAACTCAGCATTTGGGGGG + Intergenic
1169845253 20:9983443-9983465 TGAAGTACTCTTCATTATGAGGG - Intergenic
1170286513 20:14715596-14715618 AGAGGTTCTCTGCATTTGGGTGG - Intronic
1171022047 20:21594093-21594115 TGATGTGCCCAGCATATTGGAGG - Intergenic
1172556958 20:35850675-35850697 TACTGTTCTCTCCATTTTGGGGG + Intronic
1173349464 20:42231909-42231931 TGATGGCCTCTTTATTTTGGGGG + Intronic
1175612850 20:60365732-60365754 TTATCAACTCTGCATTTTGGGGG - Intergenic
1176968520 21:15238927-15238949 AACTGTACCCTGCATTTTGGAGG + Intergenic
1177933568 21:27316055-27316077 TTATGTACTCTGCATTCCTGGGG - Intergenic
1178743916 21:35229112-35229134 TGATGTCCAATGCATCTTGGTGG - Intronic
1179527184 21:41988008-41988030 TGATGTTCTTTGCATTTGTGGGG - Exonic
1182175082 22:28277155-28277177 AGATGTCCACTGCTTTTTGGAGG - Intronic
1182415483 22:30218438-30218460 TGAAGTACTCAGCATGTTGCTGG - Intergenic
1184943376 22:47784369-47784391 TGTTGTGCTCTGCAGTTTTGGGG + Intergenic
1184943832 22:47787093-47787115 TGTTGTGCTCTGCAGTTTGGGGG + Intergenic
1185237244 22:49721373-49721395 AGATAGACTCTGCATCTTGGTGG - Intergenic
949492504 3:4602965-4602987 AGTTGTACTCTGAATTTTGTTGG + Intronic
951458732 3:22925106-22925128 GAATGTATTCTGCATTTTGTAGG - Intergenic
954454281 3:50588665-50588687 TGATGTACTCCGGATATGGGTGG + Intergenic
955207508 3:56909751-56909773 TGAAGCACTCTGCATGTTGCTGG - Intronic
957337259 3:78847423-78847445 TCAGGTACTCTACATTCTGGCGG - Intronic
957545757 3:81634461-81634483 TGTTGTAATTAGCATTTTGGGGG + Intronic
958461239 3:94399127-94399149 TGATCAACTCTGAAATTTGGTGG + Intergenic
958691871 3:97479951-97479973 TGAAGTAGTTTGCAATTTGGAGG - Intronic
963392229 3:144679966-144679988 TTATGTACTCAGCTCTTTGGGGG - Intergenic
964388143 3:156171027-156171049 TTACGTACACTGCTTTTTGGCGG + Intronic
966590088 3:181673256-181673278 TCTTGTACTATGCATTTTTGGGG - Intergenic
966736112 3:183188430-183188452 TCATATACTCTGCCTCTTGGGGG + Intronic
968802135 4:2750157-2750179 TAATGTACTGTTTATTTTGGAGG - Intronic
969262039 4:6039877-6039899 TGATTGGCTCTGCATTTTGTAGG + Intronic
969826278 4:9761082-9761104 TCATGTCTTCTGCATTTTGACGG - Intergenic
970597997 4:17617424-17617446 TCATGCACTCTTGATTTTGGAGG + Intronic
975388801 4:73791825-73791847 TGATGTACTCAGCTGTGTGGGGG + Intergenic
976407565 4:84677454-84677476 TGAGGCTCTCTGGATTTTGGTGG + Intronic
979977414 4:127213945-127213967 TGATGTCCTTTGCATTTAAGTGG - Intergenic
980076932 4:128303749-128303771 TGATGAATTCTGCATTGTGCTGG + Intergenic
981149067 4:141360354-141360376 TGATGTAGTTTGTATTTTTGTGG + Intergenic
982713849 4:158785885-158785907 TGATTTACTCAGCATTTTGTTGG + Intronic
982902560 4:161025551-161025573 TGATGTACTCATGTTTTTGGAGG + Intergenic
984759254 4:183349604-183349626 TGATGTACTATGCATTCTGAAGG - Intergenic
986818987 5:11445064-11445086 TAATGTTCTCGGCATTCTGGAGG + Intronic
987372872 5:17209091-17209113 TGATGGTCTCTGCCCTTTGGAGG + Intronic
988998366 5:36736196-36736218 TGATATACTTTACAGTTTGGGGG + Intergenic
989990064 5:50752849-50752871 TGATGTAATCTTGACTTTGGAGG - Intronic
990602169 5:57370052-57370074 TGTATTACTCTGCATTTTGTAGG - Intergenic
992821278 5:80498966-80498988 TTACGAAATCTGCATTTTGGTGG + Intronic
992942757 5:81778904-81778926 TGATGTGATCTGCTTCTTGGAGG + Intergenic
994141438 5:96346068-96346090 TGATGGAGTTTGCATTTGGGTGG + Intergenic
994852281 5:105071150-105071172 TGAGGTACTCTGCACTTTAACGG - Intergenic
995784299 5:115812639-115812661 TGATTTACTATTCATTTTGGGGG + Intronic
997148237 5:131461549-131461571 TAATGTATTTTCCATTTTGGTGG - Intronic
997709238 5:135990075-135990097 TGATGAAGTCAGCTTTTTGGAGG + Intergenic
997830564 5:137146162-137146184 TGATGTCCTCTGTCATTTGGCGG - Intronic
997833108 5:137169648-137169670 TGATGTTCTCTAAATGTTGGTGG - Intronic
1002830700 6:817794-817816 TGATATACACAGCACTTTGGAGG - Intergenic
1003714195 6:8628042-8628064 TAATTTACTCAGCATTTTGCTGG + Intergenic
1004844793 6:19628024-19628046 TAATTTACTCTGCCTTCTGGTGG - Intergenic
1005299296 6:24455175-24455197 TGCTGTTCTCTGCACTTTGGAGG + Intronic
1008161132 6:48077468-48077490 TGATTCACTTTGCATTTTTGTGG + Intergenic
1008471102 6:51886168-51886190 TGGAGTAATCTGCATTTTGTTGG - Intronic
1008961198 6:57268004-57268026 TAATCTACTCAGCATTTTGCAGG + Intergenic
1010640509 6:78320627-78320649 TGTTGCACGCTGCATTATGGAGG - Intergenic
1010847782 6:80732154-80732176 TGATGGACAATGCTTTTTGGAGG + Intergenic
1014079145 6:117268322-117268344 TGATGTACTCTGCCTCTGGTGGG - Exonic
1014783143 6:125587742-125587764 TGAGGTCATCTGAATTTTGGGGG + Intergenic
1015295634 6:131588930-131588952 TTATGACCTCAGCATTTTGGAGG - Intronic
1016014481 6:139169874-139169896 TGAAATACTCTGCTTTTTGATGG + Intronic
1016235027 6:141854255-141854277 TAGTGTACTCTTCATTCTGGAGG + Intergenic
1017456706 6:154607170-154607192 TGCTTTACTATGCATTATGGAGG - Intergenic
1018921753 6:168180243-168180265 TGCTGAAGCCTGCATTTTGGGGG + Intergenic
1019116410 6:169767021-169767043 TCATTTAATCTGCATGTTGGCGG + Intronic
1022432761 7:30342814-30342836 TGAGGTACTTTGTATTTTGGGGG + Intronic
1022917832 7:34977513-34977535 TCATGTACTCAGAATTTTGGAGG - Intronic
1023994582 7:45151474-45151496 AAATGTACACTGCATTGTGGAGG + Intergenic
1027863486 7:83615691-83615713 TGCTATAATCTGCATTTAGGTGG - Intronic
1028982928 7:96987018-96987040 TTATGTACTGTGAATTGTGGAGG - Intergenic
1032058396 7:128702603-128702625 TCATTTATTCTGCCTTTTGGGGG - Intergenic
1034730085 7:153379655-153379677 TGATAGACTATGCATTTTGAAGG - Intergenic
1035776022 8:2189155-2189177 TCATTTACTCTACAGTTTGGGGG - Intergenic
1036722141 8:11186251-11186273 AGAGGTAGACTGCATTTTGGTGG - Intronic
1037174208 8:15928256-15928278 TGTTGTAATCTGGGTTTTGGTGG + Intergenic
1038858603 8:31360603-31360625 CACTGTACTCTGCATTTTGCAGG + Intergenic
1039306338 8:36267369-36267391 TGATGTTCCCTGGACTTTGGAGG + Intergenic
1039441122 8:37595976-37595998 TGATGGCCTCTGGGTTTTGGAGG + Intergenic
1042648302 8:71011760-71011782 TGATGTAACCAGCATTATGGGGG + Intergenic
1044769081 8:95610085-95610107 TAATGGACTCTGGATTTAGGGGG + Intergenic
1048704209 8:137132621-137132643 GGATGTACTCTGGATTTTTCAGG + Intergenic
1050173989 9:2851207-2851229 TTATTTATTCTGCATTCTGGAGG + Intergenic
1051473927 9:17481535-17481557 AGATGTACGCTGCAGTTGGGTGG - Intronic
1052358824 9:27532181-27532203 TGATGTAATGTGCATTTCAGAGG - Intergenic
1054721447 9:68608130-68608152 TGGTGAACCCTGCAATTTGGAGG + Intergenic
1058587161 9:106521656-106521678 ATATATATTCTGCATTTTGGGGG - Intergenic
1059536346 9:115084589-115084611 TGATGCCATCTGCATTTTAGAGG - Intronic
1060760264 9:126241167-126241189 TGATGTTCTTTGCAATCTGGAGG - Intergenic
1061650459 9:132044160-132044182 AGAAGTACTCTGAAGTTTGGGGG + Intronic
1061710705 9:132485813-132485835 AGATGACCTCTGCACTTTGGTGG - Intronic
1186455451 X:9707026-9707048 TGATGCACTCTGCGTTTTCTGGG - Intronic
1187494836 X:19786181-19786203 TAATGTACTCTGCATGTCTGGGG + Intronic
1187595632 X:20769509-20769531 ATATGTATTCTGCAGTTTGGGGG - Intergenic
1188829956 X:34884027-34884049 TGATGTGCTTAGCATATTGGTGG - Intergenic
1189613463 X:42762361-42762383 TGATGCCCTTTGGATTTTGGTGG - Intergenic
1194556233 X:95363788-95363810 TGATGTATTTTGCATTTGGGAGG - Intergenic
1194580202 X:95662478-95662500 TGATATATTTTGCCTTTTGGGGG - Intergenic
1200766175 Y:7082735-7082757 TGATGTGCTCTGCATTTTCTGGG - Intronic