ID: 935384083

View in Genome Browser
Species Human (GRCh38)
Location 2:102483136-102483158
Sequence GACACTGCTGTGACCTCTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 244
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 225}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935384082_935384083 -6 Left 935384082 2:102483119-102483141 CCGGAGTATCTGCTGAGGACACT 0: 1
1: 0
2: 0
3: 16
4: 162
Right 935384083 2:102483136-102483158 GACACTGCTGTGACCTCTGCTGG 0: 1
1: 0
2: 1
3: 17
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935384083 Original CRISPR GACACTGCTGTGACCTCTGC TGG Intronic
900189410 1:1346973-1346995 GACAGTGCTGAGAGGTCTGCGGG + Intronic
900358292 1:2275228-2275250 GCCACTGCTCTGACCTCTCAGGG - Intronic
901648629 1:10729727-10729749 CACACTGCTGTGGTCTGTGCCGG - Intronic
901668706 1:10841433-10841455 GTCCCTGCTGTGAGCACTGCTGG - Intergenic
901866357 1:12109544-12109566 GGCACTGCTGTCCCCCCTGCAGG + Exonic
902619496 1:17642652-17642674 GATATTGCTCTGACCTCAGCTGG + Intronic
902962961 1:19977700-19977722 GACCATGCTGTGTCCTCTTCTGG + Intronic
903694855 1:25199209-25199231 GACACTGCCTCGCCCTCTGCGGG - Intergenic
903930549 1:26859494-26859516 GATATTCCTGTGACCTCAGCAGG - Intergenic
907310301 1:53535275-53535297 GACTCTGGTGCGACTTCTGCTGG + Intronic
907501489 1:54884850-54884872 GAAACTGTTGGGGCCTCTGCAGG + Intronic
907530110 1:55086567-55086589 GACACTTCTGAGACCTTTGGAGG + Intronic
907825439 1:58012377-58012399 GACACCCCTGTGGCCTCTTCAGG + Intronic
907929152 1:58982834-58982856 GAACCTGCTGTGGCCTCAGCTGG + Intergenic
908002685 1:59696096-59696118 CACATTGCTGTGAGTTCTGCTGG + Intronic
908539195 1:65106505-65106527 GAGTCTGCTGTGAGCTGTGCTGG + Intergenic
909027129 1:70494975-70494997 GGCCCAGCTGTGACCCCTGCAGG + Intergenic
912605779 1:110987141-110987163 GACTCTTCTCTGACCACTGCTGG - Intergenic
912715485 1:111980801-111980823 TACATTTCTGTGACCTCAGCTGG + Intronic
912727544 1:112071839-112071861 GATACTGCTGTTATTTCTGCTGG - Intergenic
913180716 1:116318587-116318609 GCTACTGCAGTTACCTCTGCTGG + Intergenic
915016316 1:152737526-152737548 GGCACTGCTGTTGGCTCTGCTGG - Intronic
915898487 1:159829429-159829451 GTCAGTACTGTGCCCTCTGCCGG + Intronic
916458109 1:164991945-164991967 GAAAGTGCTGCCACCTCTGCTGG - Intergenic
919040332 1:192379126-192379148 GCCACTGCTGTGAGTTCTGTAGG - Intergenic
922326253 1:224531153-224531175 GACACTGATGTGACTACAGCTGG - Intronic
922401108 1:225257173-225257195 ATCACTGCTTTGACCTCTCCGGG + Intronic
924942595 1:248822366-248822388 GCCAGTGCTCTGACCTCAGCAGG - Intronic
1062885327 10:1011745-1011767 GCATCTGCTGTCACCTCTGCTGG + Intronic
1063913440 10:10855329-10855351 GACACTGCTGTCACCTAGGATGG + Intergenic
1063951030 10:11223673-11223695 CATACTGCTGTGACTCCTGCAGG - Intronic
1065017937 10:21478754-21478776 GACCCTTCTGTGAGCTCTCCCGG + Intergenic
1067223549 10:44361084-44361106 GACACTTCTTTGACTTCTGCTGG - Intergenic
1067901608 10:50247510-50247532 GACCCTGCTGTGCCTACTGCTGG + Intronic
1069678296 10:70265406-70265428 GGCACTGTTCTGACATCTGCAGG + Intronic
1072190159 10:93071910-93071932 GACCCGCCTGTGACCCCTGCAGG - Intergenic
1073118687 10:101108196-101108218 GCCCCTGCTGTGACCCCTCCTGG - Intronic
1073582917 10:104684031-104684053 GTCACTTCTGTGAACTCTCCTGG - Intronic
1074983915 10:118641135-118641157 GATGCTGCTGTGCCCTCTGAGGG - Intergenic
1076430620 10:130399385-130399407 GACAATGCTTTCTCCTCTGCTGG + Intergenic
1077143946 11:1036558-1036580 GACACTGCGGTGCCCTCAGAGGG - Intronic
1079491025 11:20989423-20989445 GAGACTGCTTTGACTTCTCCAGG + Intronic
1080158096 11:29136793-29136815 GACCCTGCTGTAACCTTGGCTGG - Intergenic
1081520724 11:43878712-43878734 GACACTGCTAAGCCCTCAGCTGG - Intergenic
1085788872 11:79478590-79478612 GACCCTGCTGTCAGCTCTCCAGG + Intergenic
1085924674 11:81001882-81001904 GAATCTGCAGTGACCACTGCAGG + Intergenic
1088534048 11:110840476-110840498 GAGACTGATGTGGCCTCTGCAGG + Intergenic
1088952239 11:114583640-114583662 GACACTGCTGTGAATTGGGCTGG + Intronic
1090860231 11:130646586-130646608 GTCACTGCTGTGGCCTGTGATGG - Intergenic
1095992888 12:48050116-48050138 GACACTGGCCTGACCTCAGCTGG - Intronic
1100274707 12:93061661-93061683 GGCACTGCTCTGAGCTCTGAAGG + Intergenic
1100686091 12:96987133-96987155 GAGACAGCTGTGCCCTCTGGAGG - Intergenic
1101193933 12:102363371-102363393 GAGACTCCTGTGCCTTCTGCTGG + Intergenic
1102576220 12:113857758-113857780 GACACAGCTGTGGCCTTTGTGGG - Intronic
1103972879 12:124682966-124682988 GCACCTGCTGTGCCCTCTGCTGG + Intergenic
1105372115 13:19811216-19811238 GACACTTCTGGGATCTCTACTGG + Intergenic
1107832835 13:44389723-44389745 GTCAGTGGTGTCACCTCTGCAGG + Intronic
1107835000 13:44405886-44405908 GGCACTGCTCTGACCTTTGAGGG + Intergenic
1108132508 13:47317976-47317998 GACACTGTGGAGACCTCTCCAGG - Intergenic
1108604744 13:52026260-52026282 CACAGTGCTGTTCCCTCTGCTGG - Intronic
1108694333 13:52889411-52889433 GAGACTGTTGTGACCTCTTGAGG - Intergenic
1112174730 13:97010780-97010802 GCCACTGCAGTGAACTCTGCTGG - Intergenic
1114385009 14:22245009-22245031 GACATTGTTGTTTCCTCTGCAGG + Intergenic
1115271824 14:31561410-31561432 AACGCTGCTGTGAGCCCTGCTGG - Exonic
1117211569 14:53506335-53506357 GCCACTGCTGTGTCCTAAGCAGG + Intergenic
1118644207 14:67821096-67821118 GACACTGATCTGACTTTTGCAGG + Intronic
1119322529 14:73740255-73740277 GTCACTGCTCTTCCCTCTGCAGG - Exonic
1120007453 14:79375437-79375459 GACACTCCTGAGACTTCAGCAGG - Intronic
1121287628 14:92748613-92748635 GGCACTGCTGTGATTGCTGCGGG + Exonic
1122134699 14:99626173-99626195 GACATTCCTGTGACCCCAGCAGG + Intergenic
1122441358 14:101734448-101734470 GACACAGCTGTGCCCTCCACAGG + Intergenic
1122988276 14:105223126-105223148 GACACTGCAGTGAGCTATGATGG + Intronic
1124497975 15:30198454-30198476 GATACTGCTGAGACCTTTGTTGG + Intergenic
1124745607 15:32340216-32340238 GATACTGCTGAGACCTTTGTTGG - Intergenic
1125760774 15:42094172-42094194 GACACTGCTGTGGTCGCTGGTGG + Intronic
1128739238 15:70072350-70072372 GACCCTGCTGTGGCCACCGCAGG + Intronic
1129856938 15:78831232-78831254 GCCACTGCTGGGACCTCACCCGG - Intronic
1129880365 15:79002801-79002823 GCCCCAGCTGTGCCCTCTGCTGG + Intronic
1130265633 15:82399830-82399852 GATACTGCTGAGACCTTTGTTGG + Intergenic
1130506381 15:84547084-84547106 GATACTGCTGAGACCTTTGTTGG - Intergenic
1132034628 15:98472211-98472233 CACAAAGCTGTGTCCTCTGCAGG + Intronic
1132151734 15:99467097-99467119 GACAGTGCCGGGACCTCAGCAGG + Intergenic
1133780672 16:8936622-8936644 GGCTCTGCAGTGGCCTCTGCTGG + Intronic
1134030950 16:10991884-10991906 GCCACTCTTGTGAACTCTGCTGG - Intronic
1134689420 16:16181508-16181530 TGCACTGCTGTTCCCTCTGCTGG - Intronic
1134896088 16:17888160-17888182 GACTCTGCAGGAACCTCTGCAGG + Intergenic
1137496267 16:48971598-48971620 GACACTGCTGTGATCAGGGCTGG - Intergenic
1138121722 16:54405700-54405722 TTCACAGCTGTGCCCTCTGCTGG + Intergenic
1138268432 16:55677479-55677501 GTCTCTGCTGGGGCCTCTGCTGG - Intronic
1139176490 16:64695609-64695631 GACACTGATGTGATCTCTTGAGG - Intergenic
1139440337 16:66963597-66963619 GACCCTGCGGGGACCTCAGCTGG - Exonic
1140477626 16:75246896-75246918 GACACAACTGTGACCTCAGAAGG + Intronic
1140891863 16:79291603-79291625 GACTCTACTCTGACCTATGCAGG + Intergenic
1141651615 16:85395937-85395959 GACAGGGCTGTGGGCTCTGCAGG - Intergenic
1142395150 16:89828053-89828075 GACACTGCGGTGACCGCGGGGGG - Intronic
1143376761 17:6471683-6471705 GTCACTCCTGGGACCTCAGCTGG - Intronic
1145263258 17:21367062-21367084 GACATATCTGTGGCCTCTGCTGG + Intergenic
1147969649 17:44212549-44212571 GACACTGATGTGACCTCCCATGG - Intronic
1148219343 17:45850882-45850904 GCCCCTGCTGTGCCCTCTGATGG + Intergenic
1148239546 17:45991166-45991188 ATCATTGCTGTGAGCTCTGCTGG + Intronic
1149005072 17:51796833-51796855 GGCTTTGCTGTGACCTCTCCAGG - Intronic
1149226141 17:54473255-54473277 GCCATTGCTAAGACCTCTGCAGG + Intergenic
1149749628 17:59133040-59133062 GACACTGCAGTGAGCTATGATGG - Intronic
1150616143 17:66773732-66773754 GACAGTGCTGTGGCATCTCCAGG + Intronic
1152784835 17:82242195-82242217 GCCACTGCTGTGTGCTCTGGGGG + Intronic
1155728526 18:29121377-29121399 GACACTGCAGTGAGCTATGATGG - Intergenic
1156270067 18:35522505-35522527 GACAGTGTTGTTACCTCTGAAGG - Intergenic
1157438333 18:47690024-47690046 GACACTACAGTAACCTCTGAAGG + Intergenic
1160398134 18:78587227-78587249 GCCACAGCTGTGAACTCTGGTGG - Intergenic
1160699568 19:499234-499256 TGCACGGCTGTGCCCTCTGCCGG + Intronic
1160843981 19:1158667-1158689 GACTGTGCGGTGGCCTCTGCCGG - Intronic
1160853369 19:1205479-1205501 GCCACGGCTGTGACCTCGGTGGG - Intronic
1161580279 19:5077138-5077160 TGCCCTGCTGTGAGCTCTGCAGG - Intronic
1162075274 19:8182583-8182605 GACACTGCAGTGAACTGTGATGG + Intronic
1163572546 19:18090946-18090968 GCCTCTGCTGTGGCCTCTGCCGG - Intronic
1165068966 19:33244477-33244499 GAGACTGCAGTGAGCTCTGATGG - Intergenic
1165634044 19:37325608-37325630 GAGACTGCAGTGAGCTATGCTGG - Intronic
1165865256 19:38932956-38932978 GACACTGTACTGCCCTCTGCTGG + Exonic
1166656825 19:44618372-44618394 CACACTCCTGTGTCCCCTGCTGG - Intronic
1167254228 19:48417722-48417744 GACACGCCTGTCACCTCTGCTGG - Intronic
1168400165 19:56081012-56081034 GACACGGCGGTGACCTCGACAGG + Intergenic
925351667 2:3205234-3205256 GACACTGCTCTGAGCTGAGCAGG + Intronic
925590809 2:5507667-5507689 GACACGGCTGTGGCCTCTGAGGG - Intergenic
926670146 2:15569197-15569219 GAGACTGCTGTGAGCTATGACGG + Intergenic
929785857 2:44990635-44990657 GAAACTGCAGTGATCTGTGCTGG + Intergenic
931187930 2:59971738-59971760 GTCTCTGCTGAGACCTCTGATGG - Intergenic
931720376 2:65063009-65063031 GACACTCCTGTCACAGCTGCCGG - Intronic
934226597 2:90137599-90137621 GACACTGCTGTGAGCACCACTGG - Intergenic
934232609 2:90198869-90198891 GACACTGCTGTGAGCACCACTGG - Intergenic
935193109 2:100794056-100794078 GACACAGCTGTGACTCCTGCCGG - Intergenic
935278465 2:101496505-101496527 GAAACTGCTTGGGCCTCTGCAGG - Intergenic
935384083 2:102483136-102483158 GACACTGCTGTGACCTCTGCTGG + Intronic
936461005 2:112713774-112713796 GAGACAGCTGTGTCCTCTCCTGG - Intergenic
937863185 2:126729484-126729506 GGCTCAGCTGTGGCCTCTGCAGG - Intergenic
938109186 2:128552759-128552781 GCCCCTGCTGGGCCCTCTGCTGG + Intergenic
942626463 2:177906265-177906287 GGCACTGCACTGCCCTCTGCTGG - Intronic
942642200 2:178072222-178072244 AACGCTGCTGCCACCTCTGCAGG + Exonic
943362305 2:186934618-186934640 GAGAGTGCTCTGAGCTCTGCCGG - Intergenic
948501353 2:238397243-238397265 GGCAGTGCTGTGTCCTCTGATGG + Intronic
948504781 2:238421500-238421522 GACCCCAGTGTGACCTCTGCAGG + Intergenic
948506156 2:238428055-238428077 GTCACTGCAGTATCCTCTGCTGG - Intronic
948537498 2:238657057-238657079 GACACTGATGTGTCTGCTGCGGG + Intergenic
948917738 2:241045258-241045280 GATTCTGCTGAGACCTCTGTTGG - Intronic
948965455 2:241376230-241376252 GACACTGCAGTGCCCACTTCTGG - Intronic
1171955467 20:31459174-31459196 GACACTGCTGTGAACTGAGATGG - Intergenic
1172315130 20:33947944-33947966 GGCACTACTGTGACTTGTGCAGG - Intergenic
1172845560 20:37928068-37928090 GACACGGCTGTGGCCTCTCCAGG - Intronic
1172900622 20:38332011-38332033 GCCCCTGCTGTTTCCTCTGCTGG - Intronic
1173404610 20:42753716-42753738 GACACTGATTTGTCCTCTGCTGG - Intronic
1174545567 20:51322578-51322600 GCTCCTGCTGTGTCCTCTGCCGG + Intergenic
1174561623 20:51434602-51434624 GACACAGCTGTGAACACTACAGG - Intronic
1174674030 20:52336360-52336382 GACACTGCTGTCATCATTGCTGG + Intergenic
1174979528 20:55377855-55377877 GACCCTGCAGTGACCACTACAGG - Intergenic
1174985523 20:55447613-55447635 AACACTGCTGGGAACTCTGAAGG + Intergenic
1175839931 20:62020256-62020278 GGCACCGCTGTGCCCTCTGCCGG + Intronic
1178236998 21:30854549-30854571 GAAATGGCTATGACCTCTGCTGG - Intergenic
1180024711 21:45153847-45153869 GCCAATGCTGTGACCTCTTGAGG - Intronic
1180102291 21:45594480-45594502 GAGACTGCAGTGACCTGTGACGG - Intergenic
1180715473 22:17869060-17869082 GGCTCTGCTGTGTCCTCTCCTGG - Intronic
1182461737 22:30488299-30488321 GATTCTGCTCTCACCTCTGCAGG + Intergenic
1182755798 22:32677930-32677952 GACCATGCTGTGTCTTCTGCAGG - Intronic
1183619508 22:38964470-38964492 GACACTGCTGGGACCTGGGCTGG + Intronic
1183640308 22:39088770-39088792 GACACTGCTGAGACCTGGGCTGG + Intergenic
1184412674 22:44333832-44333854 GGCAGTGCTGTGACCTCTTTAGG - Intergenic
1185213223 22:49583696-49583718 GACGGTGCTGTGAGCCCTGCTGG - Intronic
952274533 3:31864608-31864630 GTCACTGCTGTTTCCTTTGCTGG - Intronic
954108086 3:48419884-48419906 GGCACTGCTGCTACCTCTGAGGG + Exonic
954613184 3:51956802-51956824 GCACCTGCTGTGACCTGTGCAGG - Exonic
954888268 3:53897283-53897305 GAGGTTGCTGTGACCTCAGCTGG + Intergenic
955330722 3:58044809-58044831 GACAGTGCTGTCTCCTCTGCAGG - Intronic
955560383 3:60182716-60182738 GACACTGCAGTGAGCTATGATGG + Intronic
957228693 3:77482634-77482656 GACACTTGTCTGAGCTCTGCAGG - Intronic
960025179 3:113000845-113000867 CACAGTGCTGTGACCTTTTCTGG + Exonic
961365893 3:126398993-126399015 GGCACTGCTGTGTCCTCCACAGG + Intronic
961430536 3:126879309-126879331 GACATTGCTGTGGCCATTGCTGG + Intronic
961472380 3:127124048-127124070 ACCACTGCTGTGGCCCCTGCTGG - Intergenic
963088476 3:141460293-141460315 GGTACGGCAGTGACCTCTGCTGG - Intergenic
963728243 3:148945909-148945931 GCATCTGCTGTTACCTCTGCTGG + Intergenic
964169819 3:153756673-153756695 GACACTGCTGACATCTTTGCTGG + Intergenic
964716565 3:159728631-159728653 TGCTCTGCTGTGACCACTGCAGG - Intronic
966830737 3:184006155-184006177 CACACTGTTGTTACCTCAGCCGG + Intronic
968563769 4:1298571-1298593 GACACTGCTGAGACCCATGATGG + Intronic
968904559 4:3445383-3445405 AAAACTGCTGTGACCTCGGTGGG - Intronic
968912536 4:3483462-3483484 GCCACTGATGTCAGCTCTGCTGG + Intronic
969222920 4:5773064-5773086 GACACTGCGGTGACCGAGGCAGG - Intronic
977375854 4:96203141-96203163 GACCATGCTGTGAGCTCTGAAGG + Intergenic
980625085 4:135364649-135364671 GAGACTGCAGTGAGCTCTGATGG + Intergenic
984635138 4:182102127-182102149 GACACTGCTGAGGCCTGTGTAGG + Intergenic
985706398 5:1403664-1403686 GACACAACTGTGACCCATGCGGG + Intronic
993252624 5:85548665-85548687 GGCACTCCTGTGACCACTGCTGG - Intergenic
997633944 5:135390689-135390711 GTCAATGCTGTGACCACTGGAGG + Intronic
1001182215 5:169531050-169531072 GACACTGCAGTGACCTCTGATGG + Intergenic
1001402146 5:171451793-171451815 GTCCATGCTGTGCCCTCTGCCGG + Intronic
1001570341 5:172726721-172726743 GCCACAGCTGTTCCCTCTGCTGG + Intergenic
1002572083 5:180145814-180145836 GCTGCTGCTGGGACCTCTGCAGG + Intronic
1008181017 6:48329052-48329074 GACACTGCTTAGACCTATGTAGG + Intergenic
1008658748 6:53644002-53644024 GAGAGCCCTGTGACCTCTGCAGG - Intergenic
1010029385 6:71257345-71257367 GATGCGGCTGTGTCCTCTGCGGG - Intergenic
1010771573 6:79838001-79838023 GACACTGTTGTAACCTCAGGTGG - Intergenic
1010771773 6:79840162-79840184 GACACTGCTGTCTCCTTTACTGG - Intergenic
1013663768 6:112325945-112325967 GACAGTGCAGAGGCCTCTGCTGG - Intergenic
1014837165 6:126172673-126172695 CTCACAGCTGTTACCTCTGCAGG + Intergenic
1016417459 6:143847746-143847768 GACACTTCAGTGACCTTTGCAGG + Intronic
1017070494 6:150571727-150571749 CACTCTGCTGTTCCCTCTGCAGG + Intergenic
1018680435 6:166259796-166259818 GAAGCTCATGTGACCTCTGCTGG - Intergenic
1018705827 6:166462471-166462493 GGTACTGCTGTGACCTCCTCTGG + Intronic
1018923594 6:168192074-168192096 GGAAGTGCTGTGACCTCTGAGGG + Intergenic
1018956232 6:168412389-168412411 GTCCCTGCTTTGACCTCGGCTGG + Intergenic
1023264701 7:38392878-38392900 CACACTGCTGTGGCCGCTGGAGG + Intronic
1024326104 7:48110329-48110351 GGCACTGCACTGCCCTCTGCTGG + Intergenic
1024429075 7:49264718-49264740 GGCACAGCTTTGACCTCCGCTGG + Intergenic
1025092267 7:56073948-56073970 GAGACTGCAGTGAGCTCTGATGG + Intronic
1026876615 7:73882843-73882865 CTCACAGCTGTCACCTCTGCAGG - Intergenic
1028899836 7:96084990-96085012 GAGACTGCTGTGAGCACTGATGG + Intronic
1031100387 7:117472604-117472626 GGAACTGCTGTGACCTGTGCAGG - Intronic
1031592377 7:123609446-123609468 GACACTGATGTGACAGGTGCTGG + Intronic
1031732492 7:125315983-125316005 GAGACTGCTTTGAGTTCTGCTGG + Intergenic
1033453326 7:141481075-141481097 GACCCTGCAGTCACCGCTGCTGG + Intergenic
1034849359 7:154479634-154479656 GGCAATGCTGTGACCACTTCTGG - Intronic
1036692020 8:10950119-10950141 CTCTCTGCTGTGACCTCTTCTGG - Intronic
1039355534 8:36811446-36811468 GACACTGCTGTATCATCTTCTGG - Intronic
1047773548 8:128049921-128049943 GACACTGCTGTATCCCCTGAGGG + Intergenic
1049104579 8:140603919-140603941 GCTTCTGCTGTGCCCTCTGCTGG + Intronic
1049761894 8:144335541-144335563 GAGACTGCTGCTGCCTCTGCTGG + Intronic
1050003129 9:1099556-1099578 GCCTCTTCTGTGACTTCTGCTGG + Intergenic
1050821072 9:9880821-9880843 GATGCTGCTTTGACCTTTGCTGG + Intronic
1051195087 9:14555512-14555534 TACACTGCTTGGACCTCTGAAGG - Intergenic
1051213307 9:14768693-14768715 ATGACTACTGTGACCTCTGCTGG + Intronic
1051600312 9:18865851-18865873 GACAGTGCTGTCTCCTCTCCAGG - Intronic
1056873799 9:90308495-90308517 AACAGAGCTGTGAACTCTGCTGG - Intergenic
1057422744 9:94925673-94925695 GACACTGATGTGCACACTGCTGG - Intronic
1061578569 9:131522910-131522932 CACGCTGCTCTGACCTCTGCAGG + Exonic
1062387597 9:136319170-136319192 TGCACTGCTGTGCCCGCTGCGGG + Intergenic
1185512692 X:675232-675254 GAGGCTGCTGTGAGCTCTGATGG + Intergenic
1187265825 X:17732153-17732175 GACTCTGCTGTGAGCTCCCCAGG - Exonic
1187682369 X:21780191-21780213 GACCCAGTTGTGACTTCTGCTGG - Intergenic
1189332299 X:40151631-40151653 TCCACAGCTGTTACCTCTGCCGG - Intronic
1190082702 X:47369238-47369260 GAGGCTGCAGTGACCTCTGATGG - Intergenic
1192108063 X:68335365-68335387 CATACTGCTGTGTCCTTTGCAGG + Intronic
1196154672 X:112415493-112415515 GATGCTGCTGTGAACACTGCAGG + Intergenic
1196762469 X:119211862-119211884 GACACTGCTGTCAACACTGAGGG + Intergenic
1196825171 X:119735074-119735096 GCCCCTGCTGTGCCCTCTGTGGG - Intergenic
1196825322 X:119735995-119736017 GCCCCTGCTGTGCCCTCTGTGGG - Intergenic
1201678920 Y:16620489-16620511 CACACGGCTGGGAACTCTGCCGG + Intergenic