ID: 935384176

View in Genome Browser
Species Human (GRCh38)
Location 2:102484104-102484126
Sequence AACCCTTTGCTTTTACTAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 158
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 144}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935384176 Original CRISPR AACCCTTTGCTTTTACTAAG AGG Intronic
901207001 1:7503163-7503185 AAGCCTTGGCTTTTACCAACAGG + Intronic
906252239 1:44319533-44319555 AGCCCTATGCTTTCTCTAAGTGG + Intronic
906384081 1:45352364-45352386 TACCCTTTGCTTTTCCTTATGGG - Intronic
908225002 1:62047083-62047105 AACGCTTTCCTTTCCCTAAGGGG + Intronic
912498835 1:110108453-110108475 ACCCCATTGCCTTTCCTAAGGGG - Intergenic
916647308 1:166798220-166798242 AACTCCTTGCTTTTTGTAAGTGG - Intergenic
918924969 1:190771727-190771749 AATCTTTTGCTTTTAAAAAGTGG + Intergenic
919911788 1:202115647-202115669 ACCCCTTACCTTTTACTGAGGGG + Intergenic
922043361 1:221918965-221918987 AACGCTGTGCTTCTTCTAAGAGG - Intergenic
923587788 1:235290550-235290572 GACCTTTTGCTTTTACAAACAGG - Intronic
924084869 1:240440644-240440666 AATCATTTGCTTTTAATAAAGGG + Intronic
924168195 1:241307435-241307457 TACTCACTGCTTTTACTAAGTGG - Intronic
1063060688 10:2548605-2548627 AACTCATTGCTTTAAATAAGAGG - Intergenic
1063809188 10:9683439-9683461 AACCATTTGATTTTAGTAAGAGG - Intergenic
1066136080 10:32447355-32447377 AACCTTTTGGTTTTACTTATTGG + Intronic
1066607198 10:37190490-37190512 AACTCTTTCCTTTTACTTTGAGG - Intronic
1067158382 10:43801793-43801815 AATCCTTTGCTGTTTCTATGGGG + Intergenic
1073376197 10:103037123-103037145 AATCCTTTGCTGTTACAAAATGG - Intronic
1073883536 10:108010466-108010488 AAGCCTTTTCTTTTACCAAAGGG - Intergenic
1074237112 10:111596560-111596582 AACCCTTTACATTTATTAGGTGG + Intergenic
1076080382 10:127575324-127575346 AACCTTTTCCCTTGACTAAGCGG + Intergenic
1079153058 11:17918893-17918915 AACCTTTTGCTTCACCTAAGGGG - Intronic
1080540394 11:33258320-33258342 ATCCCTTTCCTTTCATTAAGGGG + Intronic
1086121048 11:83304596-83304618 CACCCCTTGCTTCTTCTAAGAGG - Intergenic
1087376469 11:97348793-97348815 AACCATTTGCTTTCAGCAAGGGG - Intergenic
1089693615 11:120201974-120201996 ACCACTTTGTTTTTAATAAGTGG + Intergenic
1094869912 12:34590313-34590335 AAACCTTTGTTTTCACTCAGAGG - Intergenic
1095892261 12:47245768-47245790 TACCTTTTGCCTTTACTAACTGG - Intergenic
1099716310 12:86296951-86296973 AACCTTTGGCTGTTACTGAGAGG - Intronic
1101042475 12:100770872-100770894 AACACTGTGCTATTTCTAAGAGG - Intronic
1104574382 12:129953492-129953514 AATGCTTTGCTTTTACTTTGGGG - Intergenic
1105571695 13:21609838-21609860 AAGCATTTGCATTTACTTAGTGG - Intergenic
1107970990 13:45641972-45641994 AACCCCTAGCTTTTGGTAAGTGG + Intergenic
1112323067 13:98424550-98424572 AACCCTTTGCTTTTGCTCTCAGG + Exonic
1113111965 13:106832863-106832885 CACTCTTTGCTTTTTCTAAGTGG + Intergenic
1115372300 14:32630718-32630740 AACCCTTTCCTGATACAAAGGGG + Intronic
1120672780 14:87383515-87383537 AACCCTTTGCCATTACACAGTGG + Intergenic
1120842415 14:89097451-89097473 AAGCCTTTCCTTTTAGTATGAGG + Intergenic
1122093365 14:99354245-99354267 GACCCTTTGCATATACTTAGGGG - Intergenic
1128653800 15:69443018-69443040 AAACCTTTGTTTTTGCTAAATGG + Intronic
1130955675 15:88625821-88625843 AGCCTTTGGCTTTTACTAATGGG + Intronic
1134424782 16:14130246-14130268 AATCCTTTGTTCTTACTAAGGGG + Intronic
1138194386 16:55041600-55041622 AACCCTTTCATTGTACTAATGGG + Intergenic
1139192389 16:64879819-64879841 AAACCTCAGCATTTACTAAGTGG - Intergenic
1140749465 16:78010117-78010139 AACACATTGCTTTTTCTCAGAGG - Intergenic
1142804986 17:2366799-2366821 AACCCTTTCCTTTTCCTGGGAGG + Intronic
1145114743 17:20198698-20198720 AACCCTTGCCTTTTATTAAGAGG + Intronic
1146925582 17:36742635-36742657 AAGCCTTTGCTTTAAATAATGGG - Intergenic
1147728213 17:42579998-42580020 AACCCTTTGCTGATCCTCAGGGG - Exonic
1150000004 17:61428799-61428821 AACTCTTTGCTCTTACAAATAGG + Intergenic
1150984442 17:70179697-70179719 AAGCTTTTGCTTTTACTGAGTGG - Exonic
1151035605 17:70795259-70795281 AACACTTTGCTTCAACTAAATGG - Intergenic
1153584013 18:6602742-6602764 AGCCCTTTGCTTTTTCTAATTGG + Intergenic
1154478151 18:14787829-14787851 AACCCTTTGCTGTTACCATCAGG - Intronic
1158194505 18:54868853-54868875 AACTCTCTGTTTTTATTAAGAGG + Intronic
1160446048 18:78927522-78927544 AACCCCCTGCCTTTATTAAGAGG - Intergenic
1161899706 19:7109399-7109421 ACACCTTTGTTTTTAATAAGTGG + Intergenic
1164664194 19:30013310-30013332 ATTCCATTGCTTTTACTAAATGG + Intronic
1165988965 19:39795051-39795073 CCCCCTTTGCTTTAACCAAGAGG - Intergenic
925649388 2:6073240-6073262 AACCCTGTGCTTTTCTTAATAGG + Intergenic
926371304 2:12181431-12181453 AACACTTAGCTGTTATTAAGCGG + Intergenic
926816037 2:16798385-16798407 CACCTTTTCCTTTTACTAAGGGG + Intergenic
928256518 2:29727636-29727658 ATCCTTGTGCTTTTACTAAGGGG + Intronic
935168888 2:100594389-100594411 TATCCTTTGCATTTACTAATTGG + Intergenic
935384176 2:102484104-102484126 AACCCTTTGCTTTTACTAAGAGG + Intronic
935434973 2:103020609-103020631 ACCCCTTTGCTTTTGCTACCAGG + Intergenic
936063801 2:109315458-109315480 ATGCACTTGCTTTTACTAAGAGG + Intronic
937309925 2:120895841-120895863 AAACCTTTCCTTTTAAAAAGAGG - Intronic
938009635 2:127818779-127818801 AACCCTTTCCTTTTATTTCGCGG + Intergenic
938112418 2:128577894-128577916 ATTCCTTTGTTTTTAATAAGTGG - Intergenic
939808640 2:146805673-146805695 AAGCCTTGGCTATTACTTAGTGG - Intergenic
940354110 2:152719178-152719200 CGCCCTTTGCCTTTTCTAAGTGG + Intronic
940393611 2:153162359-153162381 AATCCTTTGCTTTTAAAATGAGG + Intergenic
940469374 2:154075324-154075346 GACCCTTTGATATTACAAAGTGG - Intronic
941637710 2:167953543-167953565 GACCCTTATCTTCTACTAAGAGG - Intergenic
943671087 2:190661617-190661639 TACACTTAGCTTTTGCTAAGGGG + Intronic
948827834 2:240582033-240582055 AAGACTGTCCTTTTACTAAGAGG + Intergenic
1169324367 20:4663311-4663333 AACCCTTTGGTTTTACGACATGG - Intergenic
1171158565 20:22899690-22899712 AAGTCTTTTCTTTTTCTAAGAGG + Intergenic
1173937062 20:46875907-46875929 AACCCTCTGATTTTACAAATAGG - Intergenic
1177179034 21:17725150-17725172 CAGCCTTTTCTTTTACTAACAGG + Intergenic
1182320991 22:29478617-29478639 AACCCTCTGCTTTTACTTTAGGG - Intergenic
949202664 3:1397860-1397882 AACCCCATGCTGTTACTTAGAGG + Intronic
950503679 3:13380037-13380059 AACTCTTTGCTTCTACGTAGAGG + Intronic
951518954 3:23593462-23593484 AAACCTTTCCTTTGACTATGAGG + Intergenic
952994728 3:38868523-38868545 AAACCTTTGATTTAACAAAGAGG - Intronic
954993783 3:54863850-54863872 AGCCCTTTCCTTTTTCTAAAAGG - Intronic
956741021 3:72276178-72276200 AACCTGTTGATTTTCCTAAGAGG - Intergenic
957395330 3:79628775-79628797 AACCCTTTGCTTTTAGTCTGTGG - Intronic
960267237 3:115634213-115634235 AATCGGTTGCTTTTATTAAGTGG + Intronic
960400668 3:117193860-117193882 TTCCTTTTGTTTTTACTAAGTGG + Intergenic
962515605 3:136147621-136147643 AACCCTCAGCTTTTATCAAGGGG - Exonic
962664738 3:137642610-137642632 AAACCTGTGCTTTTATTTAGGGG + Intergenic
963396749 3:144744278-144744300 AACCATTTGCTTTAATGAAGTGG + Intergenic
970781216 4:19740213-19740235 AAAGCTTTGCTTTTATTAAATGG - Intergenic
978376373 4:108078615-108078637 AACCCTTTGGTTTGAGAAAGTGG + Intronic
980959679 4:139462631-139462653 AACTCTTTGCTTTTTGTATGTGG + Intronic
982227817 4:153181923-153181945 AACACTTTGCTTTTAGAAATGGG + Intronic
982704513 4:158692598-158692620 AACCATATTCTTTTACTGAGAGG - Intronic
982788442 4:159562415-159562437 AACCCTCTGCTTTTCTTAGGAGG + Intergenic
984323851 4:178226937-178226959 ACCCCTTTACTTTAACTGAGAGG - Intergenic
988778674 5:34499632-34499654 AGCCCTTCGCTTTTCCTAATAGG + Intergenic
990462759 5:56045128-56045150 AACTCTTTGCTTTTGCAAATGGG + Intergenic
992100074 5:73398471-73398493 AAGACTTTGCTTTGACCAAGTGG - Intergenic
993119866 5:83761513-83761535 AACCTTTTGAATTTACTTAGAGG - Intergenic
993129619 5:83879097-83879119 CACCCTTTGCTTTCCCTTAGAGG + Intergenic
993682949 5:90902228-90902250 AACCATTTTCTGTTATTAAGTGG + Intronic
994512105 5:100717454-100717476 AACCTTTTGCTTTTACCAAAAGG + Intergenic
995827461 5:116316512-116316534 GACCCTTTGCTATTACACAGTGG + Intronic
997463115 5:134069021-134069043 TAAACTTTGCTTTTACTAAAAGG - Intergenic
998136886 5:139678662-139678684 AACCCTCTGCATTTACAGAGGGG - Intronic
998470009 5:142376231-142376253 ATCCCTTTGTTTTTTCTAAAGGG - Intergenic
999229081 5:150051068-150051090 AACCCTCTCCTTTTATTAAAAGG + Intronic
999518949 5:152330671-152330693 CAACCCTTGCTTTTACTATGGGG + Intergenic
1000667714 5:164019498-164019520 AACTATTTGCTTTTACTACCTGG + Intergenic
1002948688 6:1787068-1787090 AGCCTTTCGCTTTTATTAAGTGG - Intronic
1004981666 6:21031346-21031368 AACACTCTGCTTTTATTAAAGGG + Intronic
1013436032 6:110108372-110108394 AAACCTTTGCTTTTATTCATTGG - Intronic
1015974575 6:138776208-138776230 AACCCTGTGCTTTTACTCACTGG - Exonic
1017324451 6:153130412-153130434 CTCCCTTTCCTTTGACTAAGGGG + Intronic
1020816923 7:12917053-12917075 AACCCTTTGCTATTATTATGTGG - Intergenic
1021332474 7:19355801-19355823 CACCCTTTGACTTTTCTAAGAGG + Intergenic
1022744518 7:33156979-33157001 AAGCCTGTTATTTTACTAAGTGG + Intronic
1027572463 7:79887373-79887395 ATCACTTTGCTTTTACCTAGAGG + Intergenic
1027969682 7:85062796-85062818 AACCTTTTCCTGTAACTAAGTGG - Intronic
1030448292 7:109675035-109675057 AACCTGTTGCTTTTTGTAAGTGG + Intergenic
1033146791 7:138878118-138878140 AACTCTTCCCTTTTTCTAAGGGG + Intronic
1034522846 7:151633223-151633245 ACCCCTTTTCTTTTTTTAAGAGG - Intronic
1036060865 8:5318777-5318799 AAGACTTTGCTGTTAGTAAGTGG - Intergenic
1038337102 8:26654268-26654290 AACCCTTTCCTCTCACCAAGGGG - Intronic
1041854874 8:62440056-62440078 GGTCCTTTGCTTTTACTAAAAGG + Intronic
1042097762 8:65236517-65236539 AACCCATTGCATCTACCAAGAGG - Intergenic
1044550223 8:93504055-93504077 AAGCCCCTGATTTTACTAAGAGG + Intergenic
1045640655 8:104246895-104246917 AGGACTTTGCTTTTACTGAGTGG + Intronic
1046760492 8:118015320-118015342 AAGCCTTTTCTTTTACCAATAGG + Intronic
1049000397 8:139822356-139822378 AACCCTTTCATTTTACAAATGGG - Intronic
1049535318 8:143177756-143177778 AACCCTTTCCTTTTCCATAGGGG + Intergenic
1050471472 9:5995624-5995646 TACCCTTTGCATTTCCTAACTGG - Intronic
1051179893 9:14400244-14400266 ATCCCTGTGCATTTACTGAGTGG - Intergenic
1052185012 9:25582743-25582765 AGCCCATTGCTTATACAAAGTGG - Intergenic
1054162862 9:61689614-61689636 AAACCTTTGCTTTGATTGAGCGG + Intergenic
1056832260 9:89926752-89926774 AACTCTTTGCTTTCACTGTGTGG + Intergenic
1062145501 9:134987503-134987525 AACCCTTTCCCTTCACTAAGGGG - Intergenic
1185829319 X:3284544-3284566 AATACATTGCTTTTACTGAGAGG - Exonic
1188056978 X:25552876-25552898 TACCATTTCCTTTTAGTAAGAGG + Intergenic
1188506557 X:30889810-30889832 AACCCTTTGCTTGTCCTTATGGG + Intronic
1191612968 X:63136482-63136504 CACCCTTGCCTTTTATTAAGAGG - Intergenic
1191623329 X:63242444-63242466 CACCCTTGCCTTTTATTAAGAGG + Intergenic
1192877151 X:75242927-75242949 AACCATTTGCATGTACTAATAGG - Intergenic
1195281886 X:103343814-103343836 ATCCCATTGTTTTTTCTAAGGGG - Intergenic
1196389798 X:115195560-115195582 ACCACTTTGGTTTTTCTAAGTGG - Intronic
1197111981 X:122786832-122786854 AACCATTTACTTGTATTAAGTGG + Intergenic
1197231394 X:124007351-124007373 AACACTTTGCTTATCCTTAGTGG - Intronic
1198091737 X:133337672-133337694 AAGCCTTTTCTTTTACTTTGGGG - Intronic
1198228914 X:134671134-134671156 AGTCCTTTGCATTTACTCAGGGG - Intronic
1201856847 Y:18553855-18553877 AACACTTTGCTACAACTAAGAGG + Intronic
1201876474 Y:18766525-18766547 AACACTTTGCTACAACTAAGAGG - Intronic
1202045356 Y:20731830-20731852 AACCCTTTCCATTTCTTAAGGGG - Intergenic