ID: 935384848

View in Genome Browser
Species Human (GRCh38)
Location 2:102489199-102489221
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 458
Summary {0: 1, 1: 0, 2: 2, 3: 45, 4: 410}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935384842_935384848 -3 Left 935384842 2:102489179-102489201 CCTAAAGTCATTTGCTCCAAATT 0: 1
1: 0
2: 2
3: 26
4: 291
Right 935384848 2:102489199-102489221 ATTGATGTGGGGAGTGAAGGAGG 0: 1
1: 0
2: 2
3: 45
4: 410

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type