ID: 935385995

View in Genome Browser
Species Human (GRCh38)
Location 2:102500786-102500808
Sequence GCCTCACGTTTGTTTGAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 62
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 58}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935385995_935385998 -10 Left 935385995 2:102500786-102500808 CCTCCCTCAAACAAACGTGAGGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 935385998 2:102500799-102500821 AACGTGAGGCATTCTTTAGAAGG 0: 1
1: 0
2: 0
3: 5
4: 83
935385995_935386000 0 Left 935385995 2:102500786-102500808 CCTCCCTCAAACAAACGTGAGGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 935386000 2:102500809-102500831 ATTCTTTAGAAGGGAGAGCAAGG 0: 1
1: 0
2: 1
3: 26
4: 215
935385995_935386001 6 Left 935385995 2:102500786-102500808 CCTCCCTCAAACAAACGTGAGGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 935386001 2:102500815-102500837 TAGAAGGGAGAGCAAGGAGAAGG 0: 1
1: 0
2: 5
3: 97
4: 1005
935385995_935385999 -9 Left 935385995 2:102500786-102500808 CCTCCCTCAAACAAACGTGAGGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 935385999 2:102500800-102500822 ACGTGAGGCATTCTTTAGAAGGG 0: 1
1: 0
2: 0
3: 4
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935385995 Original CRISPR GCCTCACGTTTGTTTGAGGG AGG (reversed) Intronic