ID: 935387992

View in Genome Browser
Species Human (GRCh38)
Location 2:102521451-102521473
Sequence TTCTCCCCATTTGGCTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 224
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 205}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935387992_935387994 -4 Left 935387992 2:102521451-102521473 CCTTGGGAGCCAAATGGGGAGAA 0: 1
1: 0
2: 0
3: 18
4: 205
Right 935387994 2:102521470-102521492 AGAACACAATTGATAAACAGAGG 0: 1
1: 0
2: 1
3: 23
4: 277
935387992_935387995 -3 Left 935387992 2:102521451-102521473 CCTTGGGAGCCAAATGGGGAGAA 0: 1
1: 0
2: 0
3: 18
4: 205
Right 935387995 2:102521471-102521493 GAACACAATTGATAAACAGAGGG 0: 1
1: 0
2: 0
3: 18
4: 318
935387992_935387997 19 Left 935387992 2:102521451-102521473 CCTTGGGAGCCAAATGGGGAGAA 0: 1
1: 0
2: 0
3: 18
4: 205
Right 935387997 2:102521493-102521515 GCAGTTACAAGCCTATGAGGTGG 0: 1
1: 0
2: 1
3: 4
4: 76
935387992_935387996 16 Left 935387992 2:102521451-102521473 CCTTGGGAGCCAAATGGGGAGAA 0: 1
1: 0
2: 0
3: 18
4: 205
Right 935387996 2:102521490-102521512 AGGGCAGTTACAAGCCTATGAGG 0: 1
1: 0
2: 0
3: 7
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935387992 Original CRISPR TTCTCCCCATTTGGCTCCCA AGG (reversed) Intronic