ID: 935388016

View in Genome Browser
Species Human (GRCh38)
Location 2:102521661-102521683
Sequence TTGTCCTGAGTTGCATTTTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 233}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935388016_935388017 22 Left 935388016 2:102521661-102521683 CCTGAAAATGCAACTCAGGACAA 0: 1
1: 0
2: 0
3: 12
4: 233
Right 935388017 2:102521706-102521728 GCAGACAATCTACATTTTTGAGG 0: 1
1: 0
2: 1
3: 12
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935388016 Original CRISPR TTGTCCTGAGTTGCATTTTC AGG (reversed) Intronic
901742827 1:11353446-11353468 TTGCCCTGAATTGCATTAGCTGG + Intergenic
902235223 1:15053114-15053136 TTCTCCCGAGTCGCACTTTCTGG + Intronic
905785934 1:40757608-40757630 TTTTCCTGAGCTGAAATTTCAGG - Intronic
906197699 1:43939198-43939220 TTGTCCTGAGTTGCAAACTGAGG - Intergenic
908576853 1:65468959-65468981 GTGAACTGAGATGCATTTTCTGG + Intronic
908993315 1:70121462-70121484 TTGTCCTGATTTGTTTTTGCAGG - Intronic
909531571 1:76687882-76687904 CTGTCAAGAGTTGCAGTTTCAGG + Intergenic
909979376 1:82080563-82080585 TTCTCATGAGGTCCATTTTCTGG + Intergenic
910929227 1:92426005-92426027 TTATTCTGAGTCACATTTTCTGG - Intergenic
911168929 1:94750445-94750467 TTTTCCAGAATTACATTTTCAGG - Intergenic
911545783 1:99214765-99214787 TTGCCCTGAGTTCCAGTTTGTGG - Intergenic
911964551 1:104350148-104350170 TTTGCCTGAGCTGCATGTTCTGG - Intergenic
913496013 1:119428922-119428944 TCTTCCCGAGTTGCATTCTCTGG + Intergenic
915819630 1:159008451-159008473 TTGTCCTGAGTTGCCCTTATAGG + Intronic
915907968 1:159893109-159893131 TTGCCCTGAGCTACATTTTTGGG + Intronic
916961555 1:169894164-169894186 TTGTCTTGACTTGAATTTTTAGG + Intronic
917057060 1:170994824-170994846 TTTTCCCGAGTTACATTTTTGGG + Intronic
918365470 1:183803719-183803741 CTGTCCTCAGTTGCATTTCGTGG + Intronic
921122899 1:212152142-212152164 TTGTCCTTATTTTCATTTTTTGG + Intergenic
921847110 1:219895617-219895639 ATGTCCTGGTTTGCATTTGCCGG - Intronic
923639824 1:235744100-235744122 TTGCTTTGAGTTACATTTTCTGG + Exonic
923924685 1:238611518-238611540 TTGTCATGAGTTGTATTCTTAGG + Intergenic
924385262 1:243493504-243493526 TTTGGCTGACTTGCATTTTCTGG + Intronic
924834508 1:247635402-247635424 TTGTCTTAAATAGCATTTTCAGG + Intergenic
1063787782 10:9405190-9405212 TTCTCCTGACTGGAATTTTCTGG - Intergenic
1064209511 10:13350410-13350432 TTCTCCTGGGTTGCATTGTCTGG + Intergenic
1065840912 10:29700375-29700397 TTTTCCTGTGTGACATTTTCAGG - Intronic
1066271812 10:33831368-33831390 TTGTCCTGAGTTTTGTCTTCTGG + Intergenic
1066507798 10:36063575-36063597 TTGTCCTCAGTTGAAGTGTCAGG + Intergenic
1067811559 10:49431057-49431079 TTTTCCAGAGTTATATTTTCAGG - Intergenic
1067959273 10:50829631-50829653 TTGTTCTGTGTTGCATTTCAGGG + Intronic
1069542102 10:69302807-69302829 TTGTTCTGAGATACATTTACAGG + Intronic
1069903795 10:71720561-71720583 CTGTCTTGAGTTGCATTTCTGGG - Intronic
1071558009 10:86621008-86621030 TTATCCTGTTTGGCATTTTCAGG - Intergenic
1073524669 10:104168990-104169012 TTGCACTGAGATGCACTTTCGGG + Intronic
1073865747 10:107801578-107801600 ATGTCCTGAGTTTCAATTTGTGG + Intergenic
1078238624 11:9509714-9509736 TAGTCCTGATTTGTCTTTTCAGG + Intronic
1078477758 11:11646841-11646863 TTTTCTTGACTTGCTTTTTCAGG - Intergenic
1079462419 11:20694347-20694369 TTGTCCAGAATGGTATTTTCTGG + Intronic
1079755021 11:24247223-24247245 TCTTCCTGGGTTGCATTTTCAGG - Intergenic
1081246500 11:40772620-40772642 TAGTTTTGATTTGCATTTTCTGG - Intronic
1082705146 11:56485584-56485606 TTTTCCTCAATTGCATTTTGAGG - Intergenic
1082910308 11:58365764-58365786 CTGTTCTGAATTGCATTTTAAGG - Intergenic
1089652779 11:119925430-119925452 TTGTCTTGGATTGCATTTTTAGG - Intergenic
1091280962 11:134381396-134381418 TTGACCTGACTTGACTTTTCTGG - Intronic
1092897814 12:13030454-13030476 TTCTCCTGGGTTTCATTTTTAGG + Intergenic
1092941893 12:13417657-13417679 TTCTCCTGAGTTGTTCTTTCAGG + Intergenic
1093505300 12:19858257-19858279 TTGTCCTGAGTGACTTTTTAAGG - Intergenic
1094747871 12:33367254-33367276 ATGTTCAGAGATGCATTTTCTGG + Intergenic
1098365154 12:69694900-69694922 ATGTGCTAAGTTGCATATTCAGG - Intronic
1101836788 12:108301467-108301489 GTGGCCTGGGTGGCATTTTCAGG - Intronic
1102759241 12:115371056-115371078 TTGTTTTGAGTTGTTTTTTCTGG + Intergenic
1103818407 12:123677654-123677676 TTCTCCTGAGCTGCTTTCTCTGG + Intronic
1106689564 13:32099749-32099771 TTGCTTTGAGTTACATTTTCTGG + Intronic
1107732265 13:43359970-43359992 ATTTCCTCAGTAGCATTTTCTGG + Exonic
1108042347 13:46350738-46350760 CAGTTCTGAGTTGCATTTTGTGG - Intronic
1108458547 13:50641999-50642021 TTGCCTGGAGTTGCATTTCCTGG - Intronic
1110285438 13:73744609-73744631 TCCTCCTGTGTTGCTTTTTCTGG - Intronic
1111288799 13:86133151-86133173 TTTTCCTAATTTGCATTGTCCGG - Intergenic
1111523315 13:89433456-89433478 TTGTCCTGGTCTTCATTTTCTGG - Intergenic
1112194604 13:97212803-97212825 TTGTCATGAGTAGCATTTGATGG + Intergenic
1112625191 13:101095980-101096002 TGGTTTTGATTTGCATTTTCCGG - Intronic
1114985332 14:28219935-28219957 TTTTGATGAGTAGCATTTTCGGG + Intergenic
1115735807 14:36328354-36328376 CTTTCCTCAGTTCCATTTTCTGG + Intergenic
1116418192 14:44703808-44703830 TTTTGCTGAGTTGAAGTTTCTGG - Intergenic
1116908675 14:50433356-50433378 TTGTACTGAGTTAAACTTTCAGG + Intronic
1117897717 14:60506077-60506099 TTCTCTAGAGTTGCATTTTGTGG - Intronic
1120469953 14:84910214-84910236 TTGTCCACAGGTGCATTTTATGG - Intergenic
1121888650 14:97568422-97568444 TTTTCCTGAGTTGCAATTCATGG + Intergenic
1122637687 14:103138112-103138134 TTCTCCTGAGTTCCATTCTTGGG + Intergenic
1124970405 15:34484324-34484346 TTGGCCTGATCTGCATCTTCCGG + Intergenic
1127951350 15:63809640-63809662 TTGTACGGAGTTGAATTTTAAGG + Intronic
1130419696 15:83732508-83732530 TTGACCAGAATTGAATTTTCTGG - Intronic
1131921799 15:97336042-97336064 TTGGACTGACTTCCATTTTCTGG + Intergenic
1132209017 15:100006903-100006925 TTGGCCTGGCCTGCATTTTCTGG - Intronic
1133128037 16:3658883-3658905 TGGTACTGAGCTGCTTTTTCTGG - Exonic
1136491423 16:30610709-30610731 TTATCCTGAGTTCCTTTTACTGG + Intronic
1137692547 16:50439367-50439389 TTGTTTTAATTTGCATTTTCTGG - Intergenic
1137847715 16:51708433-51708455 TTGGCCTGAAATGTATTTTCTGG - Intergenic
1138174677 16:54886003-54886025 ATCTACTGGGTTGCATTTTCAGG + Intergenic
1142482838 17:229373-229395 CTGTCCTGGGGAGCATTTTCAGG - Intronic
1150297353 17:64019880-64019902 TTGTGCTGAGTGGCAGCTTCAGG + Intronic
1150512330 17:65768493-65768515 TTTTCCTATGTTGCTTTTTCTGG - Intronic
1150950173 17:69794817-69794839 TTGTGATGAGCTGAATTTTCAGG + Intergenic
1156505486 18:37588007-37588029 TTGTCCTGGGTTAAATTTCCGGG - Intergenic
1158464004 18:57673372-57673394 TTGTACTGTGTTAAATTTTCTGG + Intronic
1159013904 18:63085778-63085800 TTGTCCTGACCTCCATTTTGGGG - Intergenic
1160599955 18:80004922-80004944 TTGTCCTGATTTTCATTTCTGGG - Intronic
1161454873 19:4365099-4365121 TTGCCCTGAGTTCCAATTTCCGG - Intronic
1162764883 19:12913078-12913100 TTGGGCTGACTTGCATTCTCTGG - Intronic
1163300992 19:16446168-16446190 TTGTCCTGGGTTACAGTTACAGG - Intronic
1166177559 19:41085769-41085791 TTGGCCTCAGTTTCCTTTTCTGG - Intergenic
1167826713 19:51979917-51979939 TCTTCCTCAGTTGCATTATCTGG + Intronic
926768492 2:16346748-16346770 TTGTCCTCACTTCCTTTTTCTGG - Intergenic
926773332 2:16397594-16397616 TTGAACTAAGTTGCATTTTCTGG + Intergenic
929400493 2:41574833-41574855 ATGCCCTGAGTAGCCTTTTCTGG - Intergenic
930337062 2:50061462-50061484 TTGTTTTGATTTGAATTTTCAGG - Intronic
931339910 2:61390757-61390779 TTTTCCTGAGATGAAATTTCAGG + Intronic
931603297 2:64025886-64025908 GTGTCTTGGGTTGCATTTTTCGG - Intergenic
932430131 2:71669114-71669136 TTTTCCTGCGTTGTATTATCTGG + Exonic
933044573 2:77519261-77519283 TTGTCCCGAAATGCATTTGCTGG - Exonic
933124179 2:78583536-78583558 TTGTCTTGAGATTTATTTTCAGG - Intergenic
933298575 2:80517700-80517722 TTGTCCTGAGCACCATTTTGTGG - Intronic
933678984 2:85082021-85082043 TTGTCCAGACTTTCTTTTTCTGG - Intergenic
933821322 2:86114881-86114903 ATGTCCTGTGTTGAATCTTCTGG - Intronic
935300492 2:101689875-101689897 TGACCCTGAGTTGCATTTCCAGG + Intergenic
935388016 2:102521661-102521683 TTGTCCTGAGTTGCATTTTCAGG - Intronic
937110872 2:119366592-119366614 TTGTCCAGAGATGCAACTTCCGG + Exonic
937302583 2:120852319-120852341 TCCTCCTGAGCTCCATTTTCGGG + Intronic
939365399 2:141223942-141223964 ATGTCCTGAGTGGTATTATCTGG - Intronic
940344485 2:152615230-152615252 TTCTGCTGAGGTGCATTTCCTGG + Intronic
943246521 2:185458953-185458975 CTGTACTGAGTTGGTTTTTCTGG - Intergenic
945053204 2:205845173-205845195 TTCTCTTTAGTTACATTTTCTGG - Intergenic
945737595 2:213619580-213619602 TGGTTTTGATTTGCATTTTCTGG - Intronic
946384924 2:219377508-219377530 TTGTCCTGAGTTGGATACTAGGG + Intronic
949071966 2:242030762-242030784 TTGTCTTGAGTTCCTTTCTCAGG - Intergenic
1168910552 20:1443568-1443590 TTCTCCTTAGTTGCATTTCCTGG - Exonic
1169042984 20:2511034-2511056 TTGTCCTGAGTTCCTTTCTCAGG - Intronic
1170019100 20:11815998-11816020 TTTTCCTCATATGCATTTTCAGG - Intergenic
1170107012 20:12762655-12762677 CTGCCCTGAGTAGCATTGTCAGG - Intergenic
1170369517 20:15633462-15633484 TTATCCTGAATGGCATTTTCTGG - Intronic
1170443903 20:16405454-16405476 TTCTCCTGGGTGGCTTTTTCCGG - Intronic
1172890215 20:38259029-38259051 CTGTCCTAACTTGCACTTTCTGG + Intronic
1174080877 20:47969881-47969903 TTCTCCTGAGTAGCATCTCCAGG - Intergenic
1174598770 20:51707140-51707162 CTGGCCTGAGTTCCATGTTCAGG + Intronic
1174702840 20:52626334-52626356 TTCTCCTGAGATGCTTATTCTGG - Intergenic
1176174579 20:63713538-63713560 TTTTCCTTAGTTACATTTTCAGG + Intronic
1177463922 21:21448836-21448858 TTGTTCTGATTTGCATGTTGTGG + Intronic
1179680589 21:43018329-43018351 TTGTCTTGTGTAGCAATTTCTGG + Intronic
1180114398 21:45689137-45689159 TGATCCTGAGTTAAATTTTCTGG - Intronic
1182258046 22:29052017-29052039 TTTTGCTAAGTTTCATTTTCTGG - Intronic
1185026854 22:48419223-48419245 TGTTCCTGAGATGCTTTTTCTGG - Intergenic
949244308 3:1907521-1907543 CGGTCCTGAGTTGTATTTTGAGG - Intergenic
949586479 3:5444188-5444210 TTGTCTTGTGCTGGATTTTCAGG + Intergenic
949651072 3:6160198-6160220 TCTTCCAGAGTTGCATTTGCTGG + Intergenic
953505289 3:43480240-43480262 TGGCCCTCTGTTGCATTTTCTGG - Intronic
954802608 3:53195902-53195924 CTGTTCAGAGTAGCATTTTCTGG - Intergenic
957280037 3:78138504-78138526 CTGTCCTGAGTGGCATTGACAGG - Intergenic
957440751 3:80243655-80243677 TTGTCTTGGGGTGCAGTTTCAGG + Intergenic
958686009 3:97395606-97395628 TTGTTCTGATTTGTACTTTCTGG + Intronic
959611430 3:108299521-108299543 ATGTTCTGAGTTGCAAATTCAGG + Intronic
961066178 3:123879285-123879307 TTGTCCTGAGGTTTATTTTGGGG - Intronic
961544383 3:127622133-127622155 TTGGCGTGAGTTGCGTATTCAGG + Exonic
961933417 3:130557270-130557292 TTTCCCCCAGTTGCATTTTCTGG - Intergenic
962086107 3:132193649-132193671 TTTTCCAGAATTGTATTTTCAGG + Intronic
962109535 3:132429669-132429691 TTATCCTGATTTCCATTTTGAGG + Intronic
962168743 3:133078225-133078247 TGCTCCTGAGTTGCTTTTTGTGG + Intronic
967319961 3:188185338-188185360 TGTTCCTGACTTGCATTTACTGG - Intronic
967652945 3:192008869-192008891 CTCTCATGAGTTGCATTTTTGGG - Intergenic
967946929 3:194811426-194811448 TTATCCTGATTTGCCTTTTAAGG - Intergenic
969555268 4:7904130-7904152 TTGTCTTGATTTGCATTTTTGGG - Intronic
970237377 4:13972522-13972544 TGTTCCTGAGTTGTATTTTTTGG - Intergenic
970837177 4:20423270-20423292 TTGTCCTAAGTCTCCTTTTCTGG - Intronic
970992990 4:22234812-22234834 TTGTTGTGAGTTGCGTTCTCTGG - Intergenic
971739431 4:30501643-30501665 ATGTTCTGTGTTTCATTTTCAGG - Intergenic
971760593 4:30759940-30759962 TTGTCCTGGGTTTCATTATGAGG - Intronic
974310796 4:60207415-60207437 TTTTTATGAGTGGCATTTTCAGG + Intergenic
974463270 4:62218174-62218196 TTGTCCTGTGTAGCACATTCAGG + Intergenic
976771861 4:88661958-88661980 TTGTACTGAGTTGGTTTCTCTGG + Intronic
977117987 4:93056951-93056973 TTGTTCTGAGTTTAATATTCTGG + Intronic
979975979 4:127196828-127196850 GTGCCCAGAGTCGCATTTTCAGG - Intergenic
980687372 4:136245922-136245944 TTGTCATCAGATGCATATTCTGG + Intergenic
980709517 4:136546120-136546142 TTCTTCTGAGCTACATTTTCAGG - Intergenic
980984267 4:139680566-139680588 CTGTCCTGATTTGGATTTCCTGG + Intronic
981596596 4:146430646-146430668 TTTTCCTGAGTAGCTTTTTTTGG - Intronic
983312632 4:166084108-166084130 TGGTTTTGATTTGCATTTTCTGG + Intronic
984371782 4:178876228-178876250 TTGTCCTGAGAAGCATCTTGAGG - Intergenic
986525656 5:8671885-8671907 TTATACTGAGTGGTATTTTCTGG + Intergenic
988133758 5:27140915-27140937 TTATCCTCAGTTACTTTTTCTGG + Intergenic
990632290 5:57683733-57683755 TTGGCCTAAGTTATATTTTCTGG - Intergenic
991721190 5:69495145-69495167 TTTTCTTCAGTTGCATTTTAAGG + Intronic
991904232 5:71492462-71492484 TTGTTTTGATTTGCATTTCCCGG + Intronic
992485210 5:77188398-77188420 TATTCCAGAGTAGCATTTTCAGG + Intergenic
994192461 5:96883338-96883360 ATGTCCTAAGTTGTATTTCCAGG - Intronic
996619386 5:125481545-125481567 TTCTCCTGAGTGGCATTTATGGG - Intergenic
996756498 5:126941310-126941332 TTGTGCTGAGCTGCATTTTAGGG + Intronic
997794067 5:136790216-136790238 TGGTTTTGATTTGCATTTTCTGG - Intergenic
998528336 5:142862718-142862740 TTGTCCTGAATTCCATTTATTGG + Intronic
998684088 5:144504654-144504676 CTGTCCTGATTTGTTTTTTCTGG + Intergenic
1000405919 5:160888313-160888335 TTGGCCTCTGCTGCATTTTCAGG - Intergenic
1000540018 5:162528009-162528031 TTATCCTTAGTTGCATGTTAAGG - Intergenic
1004502920 6:16225147-16225169 TGGTTTTGATTTGCATTTTCTGG - Intergenic
1006393091 6:33770424-33770446 TTTTCCCGAGTTGCGTTTCCAGG + Intergenic
1006412224 6:33880731-33880753 TTGTCCTGGGTTGCTTATACTGG + Intergenic
1006577131 6:35054809-35054831 TTGTGCTGTGTTGCTTTCTCAGG + Intronic
1009386426 6:63087844-63087866 TTGGAATGAGTTGGATTTTCTGG - Intergenic
1012963830 6:105651593-105651615 TTGTTCTCATTTGCATTTTGGGG + Intergenic
1014305782 6:119739936-119739958 TTATCCTCAGCTACATTTTCTGG - Intergenic
1016318829 6:142819829-142819851 TTGTCATAAGTTCCACTTTCTGG + Intronic
1018196426 6:161359554-161359576 TTGCCCTGAGTGGCATGTCCAGG + Intronic
1018372258 6:163179022-163179044 TTGTGATGAGCTGAATTTTCAGG + Intronic
1018428042 6:163700864-163700886 TTCTCCTGAGTTGAACTTCCCGG + Intergenic
1021482974 7:21138443-21138465 TTTTCCAGAGTTACATTTTTGGG + Intergenic
1022074212 7:26951018-26951040 TTCCCCTGACTTGCATTTCCAGG - Intronic
1022663023 7:32384159-32384181 TTGTACTGAGTGTCATTTTGTGG + Intergenic
1022769175 7:33450593-33450615 TGGTTTTGATTTGCATTTTCTGG + Intronic
1024082207 7:45864979-45865001 TGGTGCTGAGTTTCATTTTGGGG - Intergenic
1024120376 7:46231184-46231206 CTTTCCTTGGTTGCATTTTCAGG + Intergenic
1024188252 7:46976885-46976907 TTGACCTGAGCTCCATTCTCTGG + Intergenic
1024748844 7:52439406-52439428 TTCCACTGAGTGGCATTTTCCGG + Intergenic
1027390682 7:77700783-77700805 TTGTACTGAGAAGCATTTTATGG - Intronic
1030537164 7:110782898-110782920 TTTTCTTCAGTTTCATTTTCAGG - Intronic
1030698201 7:112609060-112609082 TTGATCTGAGTTGCATATCCTGG + Intergenic
1031773170 7:125871633-125871655 TTGTATTGGGTTTCATTTTCAGG - Intergenic
1032389745 7:131548100-131548122 TGGTCCTGAGGGGCAGTTTCTGG - Intronic
1035495223 7:159319536-159319558 CTCTCCTGAGTTGCATATTGAGG - Intergenic
1035849597 8:2902771-2902793 TTTTGCTGACTTGCATTTTGTGG - Intergenic
1037183992 8:16039653-16039675 TTGTTCACAGTTGCATTTTAGGG - Intergenic
1037377413 8:18246107-18246129 GTTCCCTGAGGTGCATTTTCAGG - Intergenic
1037514357 8:19615768-19615790 TTCTTCTCATTTGCATTTTCTGG - Intronic
1039747883 8:40447373-40447395 ATGTCTTGGGTTTCATTTTCTGG + Intergenic
1040018322 8:42718298-42718320 TTGTCTTGATTTGCAGTCTCTGG - Intronic
1040447505 8:47510852-47510874 TTCTCCTTAGTTGTATTTCCTGG - Intronic
1041443917 8:57929490-57929512 TTTTCCTAATTTGCATTTTGTGG + Intergenic
1041487781 8:58397897-58397919 TTTTTCTTAGGTGCATTTTCTGG + Intergenic
1044867325 8:96584934-96584956 TTGTCTTGAATTAAATTTTCTGG - Intronic
1044875170 8:96658347-96658369 TTGTCCTGAGTTCAAATTTGAGG + Intronic
1046038607 8:108874900-108874922 TTTTCCTGATTGGAATTTTCAGG + Intergenic
1046351769 8:113024672-113024694 TGGTACTGATTTACATTTTCTGG + Intronic
1047016295 8:120727093-120727115 TTTTACTGAGGTGCATTTTCTGG - Intronic
1047579220 8:126194307-126194329 ATGTCCTGAGTGGTATTGTCTGG - Intergenic
1047790519 8:128198970-128198992 GTCGCCTGTGTTGCATTTTCTGG - Intergenic
1049953124 9:664895-664917 TGGTTTTGATTTGCATTTTCTGG + Intronic
1050779458 9:9313178-9313200 GTGTCATAAGTTGCAGTTTCCGG + Intronic
1053268572 9:36734218-36734240 TTGTCCTGATTTATATTTTCAGG + Intergenic
1053508592 9:38667904-38667926 GTTTCCTTAGTTGCATTTTTAGG + Intergenic
1055090182 9:72356456-72356478 TTATCCTGCGTTGCATCTACAGG - Intronic
1055094205 9:72394036-72394058 TTGACCTGAGTAGCCATTTCAGG + Intergenic
1056951070 9:91041110-91041132 TTATCCAAAGTTTCATTTTCTGG + Intergenic
1057635378 9:96760290-96760312 TTCCCATGAGTTGCATTTGCAGG + Exonic
1058263186 9:102862658-102862680 TTTTGCTGATTTGCATTTTTTGG - Intergenic
1059216424 9:112567986-112568008 TTTTCCAGAATTGTATTTTCGGG - Intronic
1187015932 X:15329011-15329033 TTGGCCTGAACTTCATTTTCTGG - Intronic
1187143995 X:16620929-16620951 TTGTCCTCATTTCTATTTTCTGG - Intronic
1189046770 X:37601100-37601122 TTGTCATGAGTAGCATATTGTGG + Intronic
1189211473 X:39287644-39287666 TTGTGCAGAGCTGCATCTTCTGG - Intergenic
1189347926 X:40256329-40256351 TTGGGCTGGGTTGCATTTGCAGG + Intergenic
1191015427 X:55804970-55804992 TGGTCCAGAGTTTCAGTTTCTGG - Intergenic
1191974389 X:66854787-66854809 TTGTCCTTATCTGCATTTGCTGG + Intergenic
1193345556 X:80399592-80399614 TTTTACTGAATTACATTTTCAGG - Intronic
1194526728 X:94986090-94986112 TGGTCTTAATTTGCATTTTCTGG - Intergenic
1195117994 X:101718935-101718957 TTGTCCTAAGATACAGTTTCAGG - Intergenic
1197674043 X:129310721-129310743 ATGTCATGAAGTGCATTTTCTGG + Intergenic
1199662279 X:150063856-150063878 TTGTCCATACTTTCATTTTCGGG + Intergenic
1200248077 X:154536406-154536428 TTCTACTGAATTGAATTTTCAGG - Intronic
1200382198 X:155849731-155849753 TTGTCTTTATTTGCATTTTGTGG - Intergenic