ID: 935390836

View in Genome Browser
Species Human (GRCh38)
Location 2:102551164-102551186
Sequence TGGTTACATATGGCCCACCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935390836_935390848 15 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390848 2:102551202-102551224 GGGGAGGCAGCAGGGTCAGGAGG No data
935390836_935390844 -1 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390844 2:102551186-102551208 ACAGGTGACTTTATAAGGGGAGG No data
935390836_935390849 24 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390849 2:102551211-102551233 GCAGGGTCAGGAGGCAGAGAAGG No data
935390836_935390850 27 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390850 2:102551214-102551236 GGGTCAGGAGGCAGAGAAGGTGG No data
935390836_935390846 7 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390846 2:102551194-102551216 CTTTATAAGGGGAGGCAGCAGGG No data
935390836_935390841 -5 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390841 2:102551182-102551204 AACCACAGGTGACTTTATAAGGG No data
935390836_935390840 -6 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390840 2:102551181-102551203 TAACCACAGGTGACTTTATAAGG No data
935390836_935390845 6 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390845 2:102551193-102551215 ACTTTATAAGGGGAGGCAGCAGG No data
935390836_935390847 12 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390847 2:102551199-102551221 TAAGGGGAGGCAGCAGGGTCAGG No data
935390836_935390842 -4 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390842 2:102551183-102551205 ACCACAGGTGACTTTATAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935390836 Original CRISPR TGGTTACATATGGCCCACCT GGG (reversed) Intergenic
No off target data available for this crispr