ID: 935390839

View in Genome Browser
Species Human (GRCh38)
Location 2:102551174-102551196
Sequence AAGTCACCTGTGGTTACATA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935390839_935390851 28 Left 935390839 2:102551174-102551196 CCATATGTAACCACAGGTGACTT No data
Right 935390851 2:102551225-102551247 CAGAGAAGGTGGTGAGATGAAGG No data
935390839_935390845 -4 Left 935390839 2:102551174-102551196 CCATATGTAACCACAGGTGACTT No data
Right 935390845 2:102551193-102551215 ACTTTATAAGGGGAGGCAGCAGG No data
935390839_935390847 2 Left 935390839 2:102551174-102551196 CCATATGTAACCACAGGTGACTT No data
Right 935390847 2:102551199-102551221 TAAGGGGAGGCAGCAGGGTCAGG No data
935390839_935390849 14 Left 935390839 2:102551174-102551196 CCATATGTAACCACAGGTGACTT No data
Right 935390849 2:102551211-102551233 GCAGGGTCAGGAGGCAGAGAAGG No data
935390839_935390846 -3 Left 935390839 2:102551174-102551196 CCATATGTAACCACAGGTGACTT No data
Right 935390846 2:102551194-102551216 CTTTATAAGGGGAGGCAGCAGGG No data
935390839_935390848 5 Left 935390839 2:102551174-102551196 CCATATGTAACCACAGGTGACTT No data
Right 935390848 2:102551202-102551224 GGGGAGGCAGCAGGGTCAGGAGG No data
935390839_935390850 17 Left 935390839 2:102551174-102551196 CCATATGTAACCACAGGTGACTT No data
Right 935390850 2:102551214-102551236 GGGTCAGGAGGCAGAGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935390839 Original CRISPR AAGTCACCTGTGGTTACATA TGG (reversed) Intergenic
No off target data available for this crispr