ID: 935390840

View in Genome Browser
Species Human (GRCh38)
Location 2:102551181-102551203
Sequence TAACCACAGGTGACTTTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935390831_935390840 22 Left 935390831 2:102551136-102551158 CCATGGATGTGGAGATTCTTCTG No data
Right 935390840 2:102551181-102551203 TAACCACAGGTGACTTTATAAGG No data
935390836_935390840 -6 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390840 2:102551181-102551203 TAACCACAGGTGACTTTATAAGG No data
935390837_935390840 -7 Left 935390837 2:102551165-102551187 CCAGGTGGGCCATATGTAACCAC No data
Right 935390840 2:102551181-102551203 TAACCACAGGTGACTTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935390840 Original CRISPR TAACCACAGGTGACTTTATA AGG Intergenic
No off target data available for this crispr