ID: 935390844

View in Genome Browser
Species Human (GRCh38)
Location 2:102551186-102551208
Sequence ACAGGTGACTTTATAAGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935390836_935390844 -1 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390844 2:102551186-102551208 ACAGGTGACTTTATAAGGGGAGG No data
935390837_935390844 -2 Left 935390837 2:102551165-102551187 CCAGGTGGGCCATATGTAACCAC No data
Right 935390844 2:102551186-102551208 ACAGGTGACTTTATAAGGGGAGG No data
935390831_935390844 27 Left 935390831 2:102551136-102551158 CCATGGATGTGGAGATTCTTCTG No data
Right 935390844 2:102551186-102551208 ACAGGTGACTTTATAAGGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935390844 Original CRISPR ACAGGTGACTTTATAAGGGG AGG Intergenic
No off target data available for this crispr