ID: 935390847

View in Genome Browser
Species Human (GRCh38)
Location 2:102551199-102551221
Sequence TAAGGGGAGGCAGCAGGGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935390836_935390847 12 Left 935390836 2:102551164-102551186 CCCAGGTGGGCCATATGTAACCA No data
Right 935390847 2:102551199-102551221 TAAGGGGAGGCAGCAGGGTCAGG No data
935390839_935390847 2 Left 935390839 2:102551174-102551196 CCATATGTAACCACAGGTGACTT No data
Right 935390847 2:102551199-102551221 TAAGGGGAGGCAGCAGGGTCAGG No data
935390837_935390847 11 Left 935390837 2:102551165-102551187 CCAGGTGGGCCATATGTAACCAC No data
Right 935390847 2:102551199-102551221 TAAGGGGAGGCAGCAGGGTCAGG No data
935390843_935390847 -8 Left 935390843 2:102551184-102551206 CCACAGGTGACTTTATAAGGGGA No data
Right 935390847 2:102551199-102551221 TAAGGGGAGGCAGCAGGGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935390847 Original CRISPR TAAGGGGAGGCAGCAGGGTC AGG Intergenic
No off target data available for this crispr