ID: 935390912

View in Genome Browser
Species Human (GRCh38)
Location 2:102551863-102551885
Sequence CCTTCCAAGCACATTCTTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935390912_935390914 -7 Left 935390912 2:102551863-102551885 CCAAAAAGAATGTGCTTGGAAGG No data
Right 935390914 2:102551879-102551901 TGGAAGGAAATTTTCCCCCAAGG No data
935390912_935390921 28 Left 935390912 2:102551863-102551885 CCAAAAAGAATGTGCTTGGAAGG No data
Right 935390921 2:102551914-102551936 AACCCAACCCATCTAATGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935390912 Original CRISPR CCTTCCAAGCACATTCTTTT TGG (reversed) Intergenic
No off target data available for this crispr