ID: 935396275

View in Genome Browser
Species Human (GRCh38)
Location 2:102612645-102612667
Sequence CATCAGTATTTACACTAAGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935396275_935396282 13 Left 935396275 2:102612645-102612667 CCATCTTAGTGTAAATACTGATG No data
Right 935396282 2:102612681-102612703 CTCCAGGACCCTATGTGCAAAGG No data
935396275_935396278 -3 Left 935396275 2:102612645-102612667 CCATCTTAGTGTAAATACTGATG No data
Right 935396278 2:102612665-102612687 ATGTCCTTGCCAGGGCCTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935396275 Original CRISPR CATCAGTATTTACACTAAGA TGG (reversed) Intergenic
No off target data available for this crispr