ID: 935398625

View in Genome Browser
Species Human (GRCh38)
Location 2:102637430-102637452
Sequence GATCACTGGCTTAGTTGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 82
Summary {0: 1, 1: 0, 2: 1, 3: 4, 4: 76}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935398625_935398627 -3 Left 935398625 2:102637430-102637452 CCAGCACAACTAAGCCAGTGATC 0: 1
1: 0
2: 1
3: 4
4: 76
Right 935398627 2:102637450-102637472 ATCATTTCCGAGCTGTCCAGTGG 0: 1
1: 0
2: 0
3: 5
4: 70
935398625_935398631 8 Left 935398625 2:102637430-102637452 CCAGCACAACTAAGCCAGTGATC 0: 1
1: 0
2: 1
3: 4
4: 76
Right 935398631 2:102637461-102637483 GCTGTCCAGTGGGTGTGGTGTGG 0: 1
1: 0
2: 2
3: 27
4: 301
935398625_935398632 9 Left 935398625 2:102637430-102637452 CCAGCACAACTAAGCCAGTGATC 0: 1
1: 0
2: 1
3: 4
4: 76
Right 935398632 2:102637462-102637484 CTGTCCAGTGGGTGTGGTGTGGG 0: 1
1: 1
2: 5
3: 32
4: 263
935398625_935398628 -2 Left 935398625 2:102637430-102637452 CCAGCACAACTAAGCCAGTGATC 0: 1
1: 0
2: 1
3: 4
4: 76
Right 935398628 2:102637451-102637473 TCATTTCCGAGCTGTCCAGTGGG 0: 1
1: 0
2: 0
3: 5
4: 76
935398625_935398629 3 Left 935398625 2:102637430-102637452 CCAGCACAACTAAGCCAGTGATC 0: 1
1: 0
2: 1
3: 4
4: 76
Right 935398629 2:102637456-102637478 TCCGAGCTGTCCAGTGGGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935398625 Original CRISPR GATCACTGGCTTAGTTGTGC TGG (reversed) Intronic
904482388 1:30802087-30802109 GATCCCTGGTTGAGTTTTGCAGG - Intergenic
912381970 1:109252581-109252603 GATCAGTGGCTGAGATCTGCAGG - Exonic
917237974 1:172915288-172915310 GACCACTGGTTTACATGTGCTGG + Intergenic
917736136 1:177921960-177921982 GATGAGTGGCTTAGTAGGGCAGG - Intergenic
921601061 1:217106983-217107005 GAAAACTGTCTTAGTTGTTCTGG - Intronic
1063674606 10:8129401-8129423 AATCACTGGCTTATTTGTTATGG + Intergenic
1065458285 10:25930704-25930726 GATCACTGGGTCACTTGTGCTGG + Intergenic
1066491028 10:35894990-35895012 GATCACTGGTTGCGTTGGGCTGG + Intergenic
1075569227 10:123527207-123527229 AAACACTGCCTTAATTGTGCAGG - Intergenic
1078900537 11:15638397-15638419 CAGCCCTGGCTTAGTTCTGCGGG - Intergenic
1080332824 11:31159792-31159814 AATCAATGGCTTAGCTGTGTAGG + Intronic
1085397894 11:76216442-76216464 CATCACTCGGTTAGTGGTGCAGG + Intergenic
1086110344 11:83192403-83192425 GATCACTGGCTCAGTCGGACTGG - Intergenic
1087168971 11:95031185-95031207 GATCCTGGGCTTAGTGGTGCAGG - Intergenic
1093977406 12:25438321-25438343 GGCCAATGGCCTAGTTGTGCAGG - Intronic
1094723105 12:33085441-33085463 AATCACTGGCTAAGTGCTGCTGG - Intergenic
1097954942 12:65474672-65474694 GGTCACTGGCTTCATTGTGGCGG - Intronic
1103908433 12:124339232-124339254 GATGACTGGCTTAGCTGGGTGGG - Intronic
1107409875 13:40148720-40148742 GTTCATTGGCTTTCTTGTGCTGG - Intergenic
1110200699 13:72846605-72846627 GGTCACTCGCATAGTTATGCTGG + Intronic
1110405644 13:75147301-75147323 GATAACTGCCATAGATGTGCAGG + Intergenic
1117573589 14:57074218-57074240 GAGCACTGGCTTAGTTCTGCTGG + Intergenic
1120641525 14:87019233-87019255 GATGACTGTCTTAGTTGTCATGG + Intergenic
1121662725 14:95647487-95647509 CATCACTGTCTTTCTTGTGCAGG - Intergenic
1123176528 14:106424239-106424261 GAAGACTTGCTTGGTTGTGCAGG + Intergenic
1202947149 14_KI270726v1_random:39328-39350 GAAGACTTGCTTGGTTGTGCAGG - Intergenic
1124177472 15:27439806-27439828 GATCACTGGGTTATTAGTCCAGG + Intronic
1132321358 15:100927811-100927833 GCTCACAGGCTCAGTTCTGCTGG - Intronic
1146428946 17:32772740-32772762 GATCATTTGCCCAGTTGTGCAGG - Intronic
1146566578 17:33918387-33918409 AATCACTGTCTTAGTTGTTGGGG - Intronic
1146902553 17:36598105-36598127 CATCACTTGCTCAGTTGGGCCGG + Intronic
1149253071 17:54792538-54792560 GATCAGTGCCCTAGTTGTGCAGG - Intergenic
1150513171 17:65777558-65777580 GATCACTGGCCTTGGTGTGTAGG - Intronic
1154093549 18:11388000-11388022 GATCACTGCCTTAGCTGCCCAGG - Intergenic
931304900 2:61018347-61018369 AAACACTGGCTGAGTTATGCTGG - Intronic
931928363 2:67099898-67099920 GAGCACTGCCTTCTTTGTGCAGG + Intergenic
932289771 2:70566947-70566969 CATCACTGGCTTAGCTGGGATGG + Intergenic
935398625 2:102637430-102637452 GATCACTGGCTTAGTTGTGCTGG - Intronic
937661408 2:124433905-124433927 TATCACTGCCTTATCTGTGCTGG - Intronic
941017935 2:160378089-160378111 GATCACTTACTTAGATGTCCAGG + Intronic
944889113 2:204098570-204098592 GGTCACTGGCTTGGTTTTGCAGG + Intergenic
945471472 2:210232406-210232428 TCTCTCTGGATTAGTTGTGCTGG + Intergenic
946307806 2:218865974-218865996 CATCACTGGCTTTGATGTGGTGG + Intronic
1170045950 20:12085356-12085378 GAAAACTGGCTTGGATGTGCAGG + Intergenic
1170991719 20:21307671-21307693 GTTCACTGTCTTGGTTGTGCTGG - Intronic
1172257836 20:33535516-33535538 GCTCAGTGGCTTAGCTGTCCTGG + Intronic
1178396085 21:32245108-32245130 GATCATTGACTTACTTGTGAAGG + Intergenic
1181294855 22:21828812-21828834 CACCACCTGCTTAGTTGTGCAGG - Intronic
950950660 3:16995045-16995067 GACCACCTGCTTAGCTGTGCAGG - Intronic
953709889 3:45261020-45261042 GATCACTATTTTAGTTGTGGAGG - Intergenic
954972666 3:54664228-54664250 CACCACTGGCCTTGTTGTGCAGG - Intronic
955917763 3:63924002-63924024 GATCACTGGCTAATATGTGGAGG + Intronic
959670013 3:108966140-108966162 GATGAGAGGCTTAGTTCTGCTGG + Intronic
961171563 3:124801176-124801198 GTTCACTGGCTGCTTTGTGCTGG + Intronic
975240953 4:72058513-72058535 GGTCACTGGCTTAGTTGCCAGGG - Intronic
977057099 4:92205819-92205841 GAACACTGGCTTATCTGGGCAGG - Intergenic
982573069 4:157075061-157075083 CATCTCTGGCTTTGTTGTCCAGG - Intergenic
987163777 5:15172770-15172792 GTTCACAGGCTAAGTTATGCTGG + Intergenic
989070992 5:37511567-37511589 GATCTCTGTGTTAGTTTTGCTGG + Intronic
997421091 5:133767333-133767355 GCTCTCTGGCATAGCTGTGCAGG - Intergenic
999102189 5:149035797-149035819 TTTCACTGGCTTAGTTGTAAGGG - Intronic
1000602283 5:163289152-163289174 GATTAATGACTTAGTTTTGCTGG - Intergenic
1011027987 6:82890408-82890430 GAGCACGGGCATAGCTGTGCTGG + Intergenic
1012983392 6:105852956-105852978 GCTCAGTGGCTTAGCTGTCCTGG + Intergenic
1013471863 6:110473316-110473338 GATCCCTGAGTTAGTTGTCCTGG - Intronic
1026165848 7:67908714-67908736 GATCATTGGATTTGTTGAGCAGG + Intergenic
1029274692 7:99397157-99397179 GATCACTGGATTTCTGGTGCGGG + Intronic
1030027409 7:105337838-105337860 CATCACTGTCTTAGTTGACCCGG - Intronic
1032091605 7:128914260-128914282 GGGCACTGGCCTAGCTGTGCTGG + Intergenic
1036644203 8:10601842-10601864 GATCAGTGTCTTAGGAGTGCTGG + Intergenic
1037116479 8:15235568-15235590 GATCTCTGGATTATCTGTGCAGG + Intronic
1041761567 8:61372909-61372931 TATCACTGGCTAGGTTGAGCTGG + Intronic
1045813774 8:106255677-106255699 GATCATTGCTTTAGCTGTGCAGG + Intergenic
1049339841 8:142106186-142106208 GAACACAGGCATAGTGGTGCAGG + Intergenic
1053296393 9:36917248-36917270 GCTCAGTGGCTTAGCTGTCCTGG - Intronic
1058685066 9:107472816-107472838 GATTACTGGCTCGGTTTTGCTGG + Intergenic
1061032449 9:128093781-128093803 GATCACTGGCTGATTGGGGCTGG + Intronic
1186397822 X:9227582-9227604 GATCACTGCCTGATTTGTGGTGG - Intergenic
1194109609 X:89817332-89817354 AATCACTGGCTAAGTTGAGAAGG + Intergenic
1195225112 X:102784709-102784731 CAGCACTCCCTTAGTTGTGCAGG + Intergenic
1200462273 Y:3472072-3472094 AATCACTGGCTAAGTTGAGAAGG + Intergenic
1201705637 Y:16933604-16933626 GCTCACAAGATTAGTTGTGCCGG + Intergenic