ID: 935403367

View in Genome Browser
Species Human (GRCh38)
Location 2:102683408-102683430
Sequence CAAGAACCACGAGTGGAACT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 1, 2: 2, 3: 3, 4: 79}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935403361_935403367 14 Left 935403361 2:102683371-102683393 CCTTGATCTTCATCTTCATGGGT 0: 2
1: 0
2: 4
3: 22
4: 256
Right 935403367 2:102683408-102683430 CAAGAACCACGAGTGGAACTGGG 0: 1
1: 1
2: 2
3: 3
4: 79

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935403367 Original CRISPR CAAGAACCACGAGTGGAACT GGG Exonic
901720051 1:11189780-11189802 CAAGAAGCAGGAGAGGGACTGGG + Exonic
904785558 1:32980063-32980085 GAAGTACCAGAAGTGGAACTTGG - Intergenic
906536112 1:46551822-46551844 CAGGAACCAGCAGTGGAACCTGG - Intergenic
910780679 1:90928752-90928774 CAAGTGTCAGGAGTGGAACTTGG - Intronic
913070214 1:115291910-115291932 CAAGAGCCACGAGTGATTCTTGG + Intronic
923360219 1:233203817-233203839 CAGGAACCAGGAGTGGCAGTGGG + Intronic
924346999 1:243082047-243082069 CAAGAACCACAAATGGAAGAAGG + Intergenic
924796048 1:247292914-247292936 CAAGAATCTAGAGTGGTACTGGG - Intergenic
1064438156 10:15329303-15329325 ATAGAACCACAAGTGGAAATTGG - Intronic
1074422524 10:113322071-113322093 CCAGAACCACCTGTGGAGCTTGG - Intergenic
1075400957 10:122161229-122161251 CAAGAACCAGGAGAGGGGCTGGG - Intronic
1076071725 10:127495866-127495888 CAAGAGCCAGGAGAGGGACTGGG - Intergenic
1079599487 11:22293592-22293614 CAAGAACCACTAGAAAAACTGGG + Intergenic
1080046290 11:27811959-27811981 CAAGAGCTACACGTGGAACTGGG + Intergenic
1080925361 11:36750581-36750603 CAAGATCCACCCCTGGAACTGGG + Intergenic
1084411293 11:69007711-69007733 AAAAAACAACGAGTGGATCTCGG + Intronic
1090075971 11:123580237-123580259 CAAGAACCAGTAGGGGAATTAGG + Intronic
1092237650 12:6820104-6820126 CAAGAGGCAGCAGTGGAACTTGG - Exonic
1097379190 12:58874891-58874913 CCAGAACCAGGATTGGCACTTGG + Intronic
1100070995 12:90717550-90717572 CAAGAATCACCAAGGGAACTTGG + Intergenic
1107483894 13:40808224-40808246 CAAGACCCAGGAGTAGACCTGGG + Intronic
1109143835 13:58751512-58751534 AAAGAACCAGGATTGGAGCTAGG - Intergenic
1109810987 13:67512312-67512334 CTAGAACCAAGAGTGGAAGGGGG - Intergenic
1112555839 13:100467710-100467732 AAAGAACTAGGAGTGGAGCTTGG - Intronic
1119908395 14:78326279-78326301 AAAGAACCCTGAGTGGGACTGGG - Intronic
1127723093 15:61721896-61721918 GAAGAACCAGGAGAGAAACTAGG + Intergenic
1129147163 15:73658903-73658925 CAAGGAGCAGAAGTGGAACTTGG - Intergenic
1129878888 15:78994359-78994381 CAGGAACCAGGAGGGGAACATGG + Intronic
1131445571 15:92495764-92495786 CAAGCATCAAGAGTGGAACCTGG - Intronic
1133902686 16:9992230-9992252 TAAGAACCAGGATTGCAACTTGG - Intronic
1134792608 16:17003583-17003605 AAAGAACCAGAATTGGAACTTGG + Intergenic
1139148776 16:64354563-64354585 CAAGAAGAATGAGGGGAACTGGG + Intergenic
1141444559 16:84049682-84049704 CCAGGACCACGAGTGGGCCTAGG + Intergenic
1153326232 18:3823077-3823099 CAAGAACCAGAAGTGGAACTGGG - Intronic
1164730456 19:30500248-30500270 CTAGAACCAGGAGTGAGACTGGG - Intronic
926441724 2:12895834-12895856 CAAGAACCACTAGGGCAACCAGG - Intergenic
927920296 2:26967148-26967170 CAACAACAACAAGTGGAATTAGG + Intergenic
931127206 2:59291612-59291634 CAAGAACCAGGAATAGAACCTGG + Intergenic
931805566 2:65800455-65800477 GAAGGACCAAGAGTAGAACTTGG - Intergenic
933077371 2:77946015-77946037 CAGGAACCTCCAGTGGAATTCGG - Intergenic
935386553 2:102505401-102505423 CAAGAATCACGAGTGGAACTGGG + Exonic
935403367 2:102683408-102683430 CAAGAACCACGAGTGGAACTGGG + Exonic
936712897 2:115153352-115153374 TAAGAACACTGAGTGGAACTAGG - Intronic
937358567 2:121213403-121213425 CAAGAGCTCAGAGTGGAACTAGG - Intergenic
939271393 2:139944478-139944500 CTAGAATCACAAGTGGAAGTGGG - Intergenic
941733623 2:168947760-168947782 CAAGAACGACGAGTAGACTTTGG + Intronic
943285034 2:185987269-185987291 CAAGAACCACGTGTGGAAATAGG - Intergenic
945622047 2:212151956-212151978 CTAGAATAAAGAGTGGAACTTGG - Intronic
1170481019 20:16764882-16764904 CACTACCCACTAGTGGAACTTGG + Intronic
1180182919 21:46125888-46125910 CAAGAACCTCGAGTGGATTGCGG + Exonic
953460002 3:43074366-43074388 CAAGAACCACAAATGGAGCTGGG - Intergenic
953696830 3:45166396-45166418 TAAGAACCACGAGGAGAACATGG - Intergenic
955992406 3:64642286-64642308 GAAAAACCAGGAGTGGAAATGGG + Intronic
962826077 3:139101896-139101918 CAACAACCAAGATTTGAACTGGG + Intronic
966621693 3:181971576-181971598 CAAGAATGACGAGTTGGACTTGG + Intergenic
967088390 3:186114442-186114464 CAAGAACCAGGAGAGGAATAAGG - Intronic
968817838 4:2830947-2830969 CTAGAACCACGAGTGTGACAAGG - Intronic
972011821 4:34191988-34192010 CAAGAACCACAAGTGAGAGTGGG - Intergenic
975809451 4:78151348-78151370 CAAGAACCATGACTGGCACATGG - Intronic
980096480 4:128496544-128496566 CATGAACCAGAAGTGGAACAGGG + Intergenic
980763328 4:137265929-137265951 AAAGAACCAGGATTGGAACTCGG + Intergenic
980954187 4:139411380-139411402 CAAGCAGCAAGAGTGGAAGTTGG + Intronic
981757872 4:148161064-148161086 CAATAAACACCAGTAGAACTGGG + Intronic
1002447292 5:179297430-179297452 CAAGAACCAAGAGGTGAAGTTGG + Intronic
1003086708 6:3066004-3066026 CAAGCTCCACGAATGGAACGTGG + Intronic
1004767701 6:18749368-18749390 CAAGAAAAAGGAATGGAACTAGG - Intergenic
1015905879 6:138115873-138115895 CAACAACCACTCGTGAAACTTGG + Intergenic
1016093627 6:140009409-140009431 CAACCACCTAGAGTGGAACTTGG + Intergenic
1019417601 7:934561-934583 CAAGTCCCACGAGTGGGGCTGGG + Intronic
1023761295 7:43467520-43467542 CAGGAACCAAGAGTAGCACTTGG + Intronic
1026420406 7:70230959-70230981 CAGGAAGCAGGGGTGGAACTAGG + Intronic
1031992645 7:128208005-128208027 CAAGAACAGTGAATGGAACTGGG + Intergenic
1036473345 8:9070801-9070823 CATGAACCACGTTTGTAACTTGG + Intronic
1037536133 8:19826442-19826464 CAAGAAGAACCAGTGGAACTTGG - Exonic
1040871238 8:52101693-52101715 CAAGAACCTTGAGCAGAACTAGG + Intergenic
1045913891 8:107443324-107443346 ACAGAACCAGGAGTGGAACCTGG - Intronic
1048562949 8:135562179-135562201 CACTTACCATGAGTGGAACTTGG - Intronic
1049022115 8:139964480-139964502 GAAGAGCCTCGAGTAGAACTTGG - Intronic
1052808394 9:33034260-33034282 CAAGAACCAGGACTGGAGCCAGG + Exonic
1056840058 9:89991521-89991543 CAAGAACCACGTCTGTAACAGGG + Intergenic
1060606038 9:124914921-124914943 CAAGAGGCATAAGTGGAACTTGG - Intronic
1061245459 9:129399217-129399239 TAAGACACACGACTGGAACTGGG - Intergenic
1062060464 9:134492775-134492797 CGAGAACCAAGAGTGTAACATGG + Intergenic
1186587218 X:10888207-10888229 TAATAATCACCAGTGGAACTTGG + Intergenic
1186750582 X:12617831-12617853 CAAGAAACACAAATGGATCTGGG - Intronic
1195858472 X:109355927-109355949 TCAGAACCAGGACTGGAACTTGG + Intergenic