ID: 935406852

View in Genome Browser
Species Human (GRCh38)
Location 2:102718603-102718625
Sequence CACGCCAATAAGGGTGCCGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 30
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 28}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935406843_935406852 26 Left 935406843 2:102718554-102718576 CCGAGAGGAGAGGGGCGATGATG 0: 1
1: 0
2: 0
3: 10
4: 152
Right 935406852 2:102718603-102718625 CACGCCAATAAGGGTGCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 28
935406845_935406852 0 Left 935406845 2:102718580-102718602 CCCACTGCAGTCACAGACTGCCC 0: 1
1: 0
2: 0
3: 8
4: 209
Right 935406852 2:102718603-102718625 CACGCCAATAAGGGTGCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 28
935406846_935406852 -1 Left 935406846 2:102718581-102718603 CCACTGCAGTCACAGACTGCCCC 0: 1
1: 0
2: 1
3: 23
4: 319
Right 935406852 2:102718603-102718625 CACGCCAATAAGGGTGCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 28
935406842_935406852 27 Left 935406842 2:102718553-102718575 CCCGAGAGGAGAGGGGCGATGAT 0: 1
1: 0
2: 0
3: 10
4: 158
Right 935406852 2:102718603-102718625 CACGCCAATAAGGGTGCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 28
935406840_935406852 29 Left 935406840 2:102718551-102718573 CCCCCGAGAGGAGAGGGGCGATG 0: 1
1: 0
2: 0
3: 5
4: 120
Right 935406852 2:102718603-102718625 CACGCCAATAAGGGTGCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 28
935406841_935406852 28 Left 935406841 2:102718552-102718574 CCCCGAGAGGAGAGGGGCGATGA 0: 1
1: 0
2: 0
3: 6
4: 91
Right 935406852 2:102718603-102718625 CACGCCAATAAGGGTGCCGCTGG 0: 1
1: 0
2: 0
3: 1
4: 28

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935406852 Original CRISPR CACGCCAATAAGGGTGCCGC TGG Exonic
900009456 1:92584-92606 CAAGCCAGTCAGGGTGCCACTGG - Intergenic
900025566 1:269160-269182 CAAGCCAGTCAGGGTGCCACTGG - Intergenic
902896812 1:19485267-19485289 CCCGCCCAGGAGGGTGCCGCCGG - Intronic
906530488 1:46520961-46520983 CACGCCCATGAGGCTGCTGCAGG - Intergenic
922257861 1:223908493-223908515 CAAGCCAGTCAGGGTGCCACTGG - Intergenic
924339058 1:243011272-243011294 CAAGCCAGTCAGGGTGCCACTGG - Intergenic
1066101613 10:32122889-32122911 CAAGCCTATAAGGGTGGCGGTGG + Intergenic
1067559559 10:47295407-47295429 CACACCAATAAGGGAGCTGAGGG + Intergenic
1069860974 10:71471623-71471645 CACGTCAATGGGGGTGGCGCTGG - Intronic
1104709345 12:130974541-130974563 CACACCAATAAGTGTGGCGGAGG - Intronic
1110016010 13:70405005-70405027 CACACCAACAAGGATGCAGCTGG - Intergenic
1142454874 16:90214316-90214338 CAAGCCAGTCAGGGTGCCACTGG + Intergenic
1154194278 18:12254430-12254452 CACGGCAATCAGGGGGACGCGGG - Intronic
1163095719 19:15055567-15055589 CAGGCCAAGAAGGGTGCAGGCGG + Intronic
935406852 2:102718603-102718625 CACGCCAATAAGGGTGCCGCTGG + Exonic
1176039940 20:63060069-63060091 CACTCCAACAAGGGAGCCCCCGG - Intergenic
1179798637 21:43799973-43799995 CACCCCAACGAGGGGGCCGCAGG - Intronic
1179974814 21:44858596-44858618 CACGCCACGCAGGGTCCCGCAGG - Intronic
950873667 3:16250928-16250950 CACACCTATAAGTGTGCCGGAGG + Intergenic
954609421 3:51936495-51936517 CGAGCCAAGAAGGGTGCCGAGGG - Exonic
969411777 4:7033335-7033357 CACGCCAGGAAGGGTGCTGCAGG - Intergenic
979238062 4:118423962-118423984 CAAGCCAGTCAGGGTGCCACTGG + Intergenic
1019165923 6:170097553-170097575 CACGGGAATCAGGGTCCCGCAGG - Intergenic
1019189234 6:170241032-170241054 CACGGCAATGAGTGTGCGGCTGG + Intergenic
1044893754 8:96865468-96865490 CACACCAGGAAGGGTCCCGCTGG - Intronic
1049261628 8:141642076-141642098 CAGGGCAAGAAGGGGGCCGCAGG + Intergenic
1057906240 9:98985760-98985782 CACGCCACCACGGGTGCTGCTGG - Exonic
1192071849 X:67948992-67949014 CACACCAACAAGGATGCAGCTGG - Intergenic
1202385841 Y:24325758-24325780 CAAGCCAGTCAGGGTGCCACTGG + Intergenic
1202484945 Y:25344370-25344392 CAAGCCAGTCAGGGTGCCACTGG - Intergenic