ID: 935409682

View in Genome Browser
Species Human (GRCh38)
Location 2:102747967-102747989
Sequence GTAGTGTTACATGAGCAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 128}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935409682_935409691 29 Left 935409682 2:102747967-102747989 CCTTCTTGCTCATGTAACACTAC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 935409691 2:102748019-102748041 TTTTCCCTATGGTGACTTAGAGG 0: 1
1: 0
2: 1
3: 11
4: 165
935409682_935409685 0 Left 935409682 2:102747967-102747989 CCTTCTTGCTCATGTAACACTAC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 935409685 2:102747990-102748012 GAAGGTCAGGCAACTCCCCCAGG 0: 1
1: 0
2: 0
3: 10
4: 165
935409682_935409690 18 Left 935409682 2:102747967-102747989 CCTTCTTGCTCATGTAACACTAC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 935409690 2:102748008-102748030 CCAGGTAGCTTTTTTCCCTATGG 0: 1
1: 0
2: 0
3: 20
4: 164

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935409682 Original CRISPR GTAGTGTTACATGAGCAAGA AGG (reversed) Intronic