ID: 935409686

View in Genome Browser
Species Human (GRCh38)
Location 2:102748005-102748027
Sequence TAGGGAAAAAAGCTACCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 192}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935409686_935409691 -9 Left 935409686 2:102748005-102748027 CCCCCAGGTAGCTTTTTTCCCTA 0: 1
1: 0
2: 1
3: 10
4: 192
Right 935409691 2:102748019-102748041 TTTTCCCTATGGTGACTTAGAGG 0: 1
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935409686 Original CRISPR TAGGGAAAAAAGCTACCTGG GGG (reversed) Intronic