ID: 935409687

View in Genome Browser
Species Human (GRCh38)
Location 2:102748006-102748028
Sequence ATAGGGAAAAAAGCTACCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 252
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 227}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935409687_935409691 -10 Left 935409687 2:102748006-102748028 CCCCAGGTAGCTTTTTTCCCTAT 0: 1
1: 0
2: 0
3: 24
4: 227
Right 935409691 2:102748019-102748041 TTTTCCCTATGGTGACTTAGAGG 0: 1
1: 0
2: 1
3: 11
4: 165
935409687_935409700 30 Left 935409687 2:102748006-102748028 CCCCAGGTAGCTTTTTTCCCTAT 0: 1
1: 0
2: 0
3: 24
4: 227
Right 935409700 2:102748059-102748081 TCGTAGCTCTCGTATCTTCAAGG 0: 1
1: 0
2: 0
3: 2
4: 37

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935409687 Original CRISPR ATAGGGAAAAAAGCTACCTG GGG (reversed) Intronic