ID: 935409691 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:102748019-102748041 |
Sequence | TTTTCCCTATGGTGACTTAG AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 178 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 11, 4: 165} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
935409687_935409691 | -10 | Left | 935409687 | 2:102748006-102748028 | CCCCAGGTAGCTTTTTTCCCTAT | 0: 1 1: 0 2: 0 3: 24 4: 227 |
||
Right | 935409691 | 2:102748019-102748041 | TTTTCCCTATGGTGACTTAGAGG | 0: 1 1: 0 2: 1 3: 11 4: 165 |
||||
935409686_935409691 | -9 | Left | 935409686 | 2:102748005-102748027 | CCCCCAGGTAGCTTTTTTCCCTA | 0: 1 1: 0 2: 1 3: 10 4: 192 |
||
Right | 935409691 | 2:102748019-102748041 | TTTTCCCTATGGTGACTTAGAGG | 0: 1 1: 0 2: 1 3: 11 4: 165 |
||||
935409682_935409691 | 29 | Left | 935409682 | 2:102747967-102747989 | CCTTCTTGCTCATGTAACACTAC | 0: 1 1: 0 2: 0 3: 14 4: 128 |
||
Right | 935409691 | 2:102748019-102748041 | TTTTCCCTATGGTGACTTAGAGG | 0: 1 1: 0 2: 1 3: 11 4: 165 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
935409691 | Original CRISPR | TTTTCCCTATGGTGACTTAG AGG | Intronic | ||