ID: 935409691

View in Genome Browser
Species Human (GRCh38)
Location 2:102748019-102748041
Sequence TTTTCCCTATGGTGACTTAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 165}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935409687_935409691 -10 Left 935409687 2:102748006-102748028 CCCCAGGTAGCTTTTTTCCCTAT 0: 1
1: 0
2: 0
3: 24
4: 227
Right 935409691 2:102748019-102748041 TTTTCCCTATGGTGACTTAGAGG 0: 1
1: 0
2: 1
3: 11
4: 165
935409686_935409691 -9 Left 935409686 2:102748005-102748027 CCCCCAGGTAGCTTTTTTCCCTA 0: 1
1: 0
2: 1
3: 10
4: 192
Right 935409691 2:102748019-102748041 TTTTCCCTATGGTGACTTAGAGG 0: 1
1: 0
2: 1
3: 11
4: 165
935409682_935409691 29 Left 935409682 2:102747967-102747989 CCTTCTTGCTCATGTAACACTAC 0: 1
1: 0
2: 0
3: 14
4: 128
Right 935409691 2:102748019-102748041 TTTTCCCTATGGTGACTTAGAGG 0: 1
1: 0
2: 1
3: 11
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935409691 Original CRISPR TTTTCCCTATGGTGACTTAG AGG Intronic