ID: 935411859

View in Genome Browser
Species Human (GRCh38)
Location 2:102772415-102772437
Sequence GGGGACTTCCACACTGAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935411859 Original CRISPR GGGGACTTCCACACTGAGTA GGG Intronic
901582614 1:10257567-10257589 TTGGGGTTCCACACTGAGTAAGG - Intronic
903096481 1:20980333-20980355 GGGGACTTCCCCAATGCTTATGG - Exonic
908259695 1:62330267-62330289 GAGGAATTCCACGCTCAGTAAGG - Intergenic
917219621 1:172714714-172714736 GATGACTTCTACAGTGAGTACGG - Intergenic
917303704 1:173605680-173605702 GGATATTTCCAGACTGAGTATGG - Intergenic
919597952 1:199587892-199587914 GGGGTCTTCATCACTGAGCAAGG + Intergenic
921208130 1:212867052-212867074 TGGGACTTCCAAAGTAAGTATGG - Intronic
921301536 1:213755677-213755699 GGAAACTTCCACCCTGAGTGTGG + Intergenic
923457556 1:234177521-234177543 GGGGGCTTCGACACTGGGCAGGG - Intronic
1064191269 10:13208052-13208074 GGTGACTTCCACCCTGAGAAGGG - Intronic
1066454228 10:35559345-35559367 TGTGACTTCCACACTGTGCATGG - Intronic
1067223799 10:44362712-44362734 GGGGCCTTCCAGACTGACCAAGG + Intergenic
1068018975 10:51556709-51556731 GGGAACTACCAGACTGAGGAAGG + Intronic
1068939965 10:62671092-62671114 GGAGACTTCCCCACTGGGTGGGG - Exonic
1070589457 10:77791367-77791389 GAAGACACCCACACTGAGTAGGG + Exonic
1071371536 10:84956655-84956677 AGGAACTTCCAGACTGAGCAAGG - Intergenic
1072797120 10:98364618-98364640 GGGGCCTCCCACACTGACTGTGG - Intergenic
1074912427 10:117923748-117923770 AGGGACCTCCACCATGAGTAAGG + Intergenic
1077026999 11:444652-444674 GGGAACTTCCACGCTGGGTGAGG - Intergenic
1077085402 11:747566-747588 GGCGACTTCCACGGTGAGGACGG + Exonic
1079014465 11:16856827-16856849 GGAGACTTCCACTTTGAGGAAGG - Intronic
1083221803 11:61257634-61257656 GGGGGCTTCCACAGTGAGAAGGG - Intergenic
1084682308 11:70673575-70673597 GGTGACTGTCACACTGAGTCTGG - Intronic
1085253581 11:75159551-75159573 GGGGAGTTCCGCCCTGAGTCAGG + Intronic
1086124690 11:83338396-83338418 GGGGACTTCTAGACTGGGGAGGG + Intergenic
1090958659 11:131536396-131536418 GGGGACATGCACATAGAGTATGG + Intronic
1096530231 12:52237832-52237854 GGAGATTTCAACACTGAATAAGG + Intronic
1101785074 12:107875469-107875491 TGGGACTGCAACCCTGAGTATGG - Intergenic
1104156741 12:126140465-126140487 GGTGTCTTCCACACTGAACATGG + Intergenic
1106632972 13:31496279-31496301 GGGAATTGCCACACTGACTATGG - Intergenic
1107294615 13:38895962-38895984 GGGAAGATCCACACTAAGTAAGG + Intergenic
1108738348 13:53308786-53308808 GGTGACCTCCACACTCAGGATGG - Intergenic
1109103324 13:58214546-58214568 GGGGCCTTCAACACTTAGTAAGG - Intergenic
1113364269 13:109661747-109661769 TGGGACTTTCAGCCTGAGTAGGG + Intergenic
1114532501 14:23404598-23404620 GGGGACAGCCACACTGAGCTGGG - Intronic
1114868327 14:26625323-26625345 GGGGACTACCAGAGTGAGTGGGG - Intergenic
1116856879 14:49960388-49960410 GGGGGCTCCCACCCTGAGGAGGG - Intergenic
1118824748 14:69369932-69369954 GGGGATGCCCACACTGAGTGAGG + Intergenic
1119894234 14:78206375-78206397 GGGGGTTTCCACACTGTGTTTGG + Intergenic
1126371152 15:47948321-47948343 GGGGATTTGCATACTCAGTAAGG + Intergenic
1127395842 15:58543346-58543368 TGGGGCTTCCACACCGAGAAAGG - Intronic
1128335824 15:66785216-66785238 GGGGACTCCCACGCTCAGTTCGG - Intergenic
1130372065 15:83293551-83293573 AAGGACTTCCACATTGGGTATGG + Intergenic
1138483240 16:57318178-57318200 GGGGTCTGCAACACTGAGTGAGG - Intergenic
1139226329 16:65235974-65235996 GGGGCCTGACACACTGAGAAAGG - Intergenic
1139364489 16:66425639-66425661 GGGGACATCAGCTCTGAGTAAGG - Intergenic
1139931318 16:70528957-70528979 GAATACTTCCACAGTGAGTAGGG - Exonic
1142809369 17:2388045-2388067 AGGGACTGGCACACAGAGTAAGG + Exonic
1144040336 17:11404897-11404919 AGGGAGTTCCACACTGAGAAGGG - Intronic
1144703151 17:17351512-17351534 GGGGACCCCCACACTGAGCGGGG + Intergenic
1145260406 17:21351504-21351526 GGGGACATCCACACTGTTGAAGG - Intergenic
1145316213 17:21736439-21736461 GGGGACATCCACACTGTTGAAGG + Intergenic
1145714643 17:27008367-27008389 GGGGACATCCACACTGTTGAAGG + Intergenic
1151390682 17:73784850-73784872 GGGGCCTTCCACACTGACACTGG + Intergenic
1155562971 18:27100246-27100268 GGGGACTTCTAGAGTGAGGAGGG + Intronic
1156042932 18:32843687-32843709 GGGGTCTTTCACACTCAGTTTGG - Intergenic
1160010427 18:75103280-75103302 GGTGTCTTCCACAATGAGCAGGG - Intergenic
1162661059 19:12169360-12169382 GAGCATTTCCACACTGAGAAGGG + Intronic
1167110330 19:47456963-47456985 GTGGACTACCGCACTGAGGACGG - Exonic
926134715 2:10328452-10328474 AGAGACTGGCACACTGAGTAAGG + Intronic
927960071 2:27235611-27235633 GCTGACTTCTACACTGAGCATGG + Exonic
932769601 2:74493116-74493138 GGGGCCTTCTACTCTGAGTCTGG - Exonic
935411859 2:102772415-102772437 GGGGACTTCCACACTGAGTAGGG + Intronic
936405145 2:112196066-112196088 GGCAACCTCCACACTGAGTGGGG - Intergenic
937052750 2:118905728-118905750 GGGGACTGCCACTTTGAGTAGGG + Intergenic
939578244 2:143920790-143920812 GGTGTCCACCACACTGAGTAAGG + Intergenic
940998440 2:160175968-160175990 GGACTCTTTCACACTGAGTAAGG + Intronic
946337301 2:219046617-219046639 GCTGACTTCCACACTGAGGAAGG - Intergenic
947787262 2:232834464-232834486 GGTAACTTCCAAACTGAGTCTGG + Intronic
1168981490 20:2007683-2007705 GGTGACTCCTACACTGAGTAGGG - Intergenic
1170880235 20:20290576-20290598 GGCTCCTCCCACACTGAGTAGGG + Intronic
1171178557 20:23074374-23074396 GTGGCCTTCCACACTTAGGATGG - Intergenic
1173884848 20:46448020-46448042 GAGGAATCCCACAGTGAGTACGG - Intergenic
1175239822 20:57538792-57538814 GGGGACACCCACTCTGAGGAAGG + Intergenic
1175293595 20:57894302-57894324 GGGGACCTCCGCACAGAGTGTGG + Intergenic
1178676006 21:34632262-34632284 GGGGGCTCCCACCCTGAGAAAGG + Intergenic
1182080278 22:27524010-27524032 GGGGACTTCCAAAGTATGTAGGG + Intergenic
949709772 3:6860806-6860828 GGAGGCTTCCACAGTGAGTTAGG + Intronic
954144269 3:48626621-48626643 GCGGCCTGCCACAGTGAGTAGGG - Exonic
968052268 3:195663170-195663192 GGGGAGTGCGACTCTGAGTATGG + Intergenic
968103543 3:195985169-195985191 GGGGAGTGCGACTCTGAGTATGG - Intergenic
968301845 3:197622762-197622784 GGGGAGTGCGACTCTGAGTATGG - Intergenic
969259856 4:6026467-6026489 GGGGTCTTCCACACTCAGGGTGG + Intronic
975525985 4:75351079-75351101 GGGGACTTTCTCTCTGGGTAAGG - Intergenic
979560848 4:122100414-122100436 GGGGCCTTCCAGGCTGAGTTTGG - Intergenic
985091540 4:186367724-186367746 GGAAATTTCCACACTGAGTGTGG - Intergenic
985558033 5:567731-567753 GGAGGCTCCCACACTGAGGACGG + Intergenic
987788124 5:22528257-22528279 GGTCACTTCCACTGTGAGTAGGG + Intronic
990969894 5:61493914-61493936 TGGGTCTTACACACTGATTAAGG - Intronic
992364413 5:76077535-76077557 GGGTGCTGCCACACTGAGTTTGG - Intergenic
996165768 5:120220890-120220912 GGGGACTTCAAAAATGAGGATGG - Intergenic
1004502519 6:16221813-16221835 TGGGACTTCAGCACTGAGTTTGG - Intergenic
1006981923 6:38154180-38154202 GGGGGCTGCCTCACTGAGGATGG - Exonic
1007822171 6:44568781-44568803 GGGGCTTTCCCCACTGAGTAGGG - Intergenic
1010289218 6:74115977-74115999 GGAGACTTCCATACTGAAGAAGG - Intergenic
1013154133 6:107476892-107476914 GAGGAATTCCTCACTGAGTGTGG - Intergenic
1019805188 7:3118321-3118343 GGTGACATCCACACTCAGGAGGG + Intergenic
1024345617 7:48310411-48310433 GGGTCCTTCCACAATGAGCATGG - Intronic
1026151771 7:67794022-67794044 GGGGACTTTCACTCTAAGTCTGG + Intergenic
1028048921 7:86158551-86158573 GGGGACTCACACAGTGAGTAAGG - Intergenic
1034854867 7:154534224-154534246 GGGAACTTCCTCACTTATTAAGG + Intronic
1040410397 8:47148484-47148506 GGGGACTACCAGACAGAGAACGG + Intergenic
1044336563 8:90990439-90990461 GGGGACGGCCTCACAGAGTAAGG - Intergenic
1048859352 8:138712413-138712435 TGGGAGTCCCACCCTGAGTAAGG - Intronic
1049292227 8:141810277-141810299 GGGGTCTTACACACTCAGTGGGG + Intergenic
1051097410 9:13482433-13482455 GGTGACTTAGACACTGAGTGGGG + Intergenic
1052342938 9:27380879-27380901 GGGGCTTTCCACACTGCCTAAGG + Intronic
1052811095 9:33060924-33060946 CGTGACTTTCACACTCAGTATGG + Intronic
1053616398 9:39770624-39770646 GGTGACTTCCACATTGTGTTGGG - Intergenic
1053874562 9:42529931-42529953 GGTGACTTCCACATTGTGTTGGG - Intergenic
1053898048 9:42764656-42764678 GGTGACTTCCACATTGTGTTGGG + Intergenic
1054237119 9:62571765-62571787 GGTGACTTCCACATTGTGTTGGG + Intergenic
1054267772 9:62936824-62936846 GGTGACTTCCACATTGTGTTGGG + Intergenic
1054551258 9:66606276-66606298 GGTGACTTCCACATTGTGTTGGG + Intergenic
1056549755 9:87642517-87642539 GAGGCCATCCACACTGAGGAAGG - Intronic
1058412994 9:104754664-104754686 GGAGTGTTCCACACAGAGTACGG + Exonic
1061406642 9:130396053-130396075 GTGGAGATCCACAGTGAGTAGGG + Intronic
1062059970 9:134490052-134490074 GGGGACAGCCACACTGGGGAGGG - Intergenic
1186336150 X:8590810-8590832 GGTGACTTTCAAACAGAGTAGGG - Intronic
1190685440 X:52868637-52868659 AGGGACGTGCACACTGAGTCAGG + Intergenic
1194041087 X:88942739-88942761 GGGGACTTCATCTCGGAGTATGG + Intergenic