ID: 935411891

View in Genome Browser
Species Human (GRCh38)
Location 2:102772607-102772629
Sequence GGTTCTATGGGGGTACAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 71
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 65}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935411891 Original CRISPR GGTTCTATGGGGGTACAAGC TGG Intronic
901401858 1:9020161-9020183 GGGTCAGTGGGGGTAGAAGCTGG + Intronic
903758066 1:25676866-25676888 AGTTCTCTGGGGGTACAACTTGG - Intronic
906714394 1:47956154-47956176 GTTTCTATGGTGGTAGAGGCAGG - Intronic
918180602 1:182083582-182083604 GGTTCTATGGAGGAACAGCCCGG - Intergenic
919134275 1:193488839-193488861 GGGCCTTTGGGGGTAGAAGCTGG - Intergenic
1070425911 10:76286904-76286926 GGATCTATAGTGGTAAAAGCAGG + Intronic
1073102577 10:101014366-101014388 GGTGGTATGGGGGCACAAGTGGG + Intronic
1073388072 10:103144245-103144267 TATTCTATGGGAATACAAGCAGG + Intronic
1079177277 11:18153863-18153885 GGTTCTCTGTGGGTCCAACCTGG + Intronic
1083367725 11:62151608-62151630 GGTTTGATGGTGGTACAGGCAGG + Intronic
1085892929 11:80602701-80602723 GTTTCTATGGGGGTAAAAAGGGG + Intergenic
1089976030 11:122732197-122732219 GCTTCTGTGGGGGTACCAGGAGG - Intronic
1105685671 13:22778774-22778796 GGTTTTTTGGGGGTATAATCTGG - Intergenic
1106645256 13:31627379-31627401 GGATCGATGGGAGTACAAACTGG + Intergenic
1117301404 14:54432202-54432224 GGTACTCTGGGAGTACAAGCTGG + Exonic
1119264388 14:73255385-73255407 AGTTCTATGGGGGTATAAAGAGG - Intronic
1122021282 14:98839959-98839981 GGATCTTTGGGGGTTCAGGCAGG + Intergenic
1133468881 16:6054585-6054607 GGGTCTATGGAGGTGCAAACTGG + Intronic
1143473377 17:7190178-7190200 GGTTTTTTGGGGGGAGAAGCAGG - Exonic
1144237574 17:13276947-13276969 GGTTGTAAGGGGTTTCAAGCAGG + Intergenic
1151724763 17:75877599-75877621 GGGTCTATGGGGGTGTAGGCGGG - Intronic
1160271402 18:77387499-77387521 GGTCTCATGGGGGTAAAAGCAGG - Intergenic
1162968605 19:14167324-14167346 GGTGGTAGGGGGGTACAGGCAGG + Intronic
1164751342 19:30657219-30657241 GGTGCTATGTGGGTTTAAGCTGG + Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166737364 19:45093929-45093951 GGGTCTATGGGGGTAAAAAGAGG + Intronic
1166887081 19:45968240-45968262 TGTTCTATGAGGGTACGAGGAGG + Intronic
929602681 2:43214397-43214419 GGCCCTAAGGGGTTACAAGCAGG - Intergenic
931998179 2:67858891-67858913 GGTTCTATGCAGCTACAAGAGGG - Intergenic
932435823 2:71702115-71702137 GGTCCTGTGGGGGTGCACGCTGG + Intergenic
933901753 2:86855139-86855161 GGTTGTAAGGGGGAACAGGCAGG + Intronic
935411891 2:102772607-102772629 GGTTCTATGGGGGTACAAGCTGG + Intronic
935778795 2:106494124-106494146 GGTTGTAAGGGGGAACAGGCAGG - Intergenic
939482058 2:142761724-142761746 GGTCCTATGGTGGTACATGCAGG - Intergenic
1171427943 20:25060118-25060140 GGTTCCATGGGAGGATAAGCTGG - Intergenic
1174214077 20:48902910-48902932 GGTACTATGGGGGAACACACAGG - Intergenic
1180785844 22:18547240-18547262 GGTTACCTGGGGGAACAAGCTGG + Intergenic
1181131128 22:20732965-20732987 GGTTACCTGGGGGAACAAGCTGG + Exonic
1181242769 22:21486794-21486816 GGTTACCTGGGGGAACAAGCTGG + Intergenic
1185048361 22:48540365-48540387 GATTCTCTGGGGGTCCAGGCAGG - Intronic
954437814 3:50505149-50505171 AGCTCTTTGGGGGGACAAGCAGG + Intergenic
954870326 3:53763033-53763055 GGTTCTGTGAGGGCACAGGCAGG + Intronic
955056623 3:55460971-55460993 GGTTCCATGGGGGCTCAAGGAGG - Intergenic
960078618 3:113516081-113516103 GGTTCTATGGGGCTAAAAACAGG + Intergenic
961948391 3:130718907-130718929 ACTTCTGTGGGGGTACAAGTTGG - Intronic
966830948 3:184008134-184008156 GCTTCTATTGGTGGACAAGCAGG + Intronic
969708452 4:8829013-8829035 GGTTCTATGGGTTTACATGAAGG - Intergenic
971749334 4:30626034-30626056 GGTTTTATGGGGGGATAAGTAGG + Intergenic
976602072 4:86946862-86946884 GGTGCTATTGGGTTGCAAGCAGG + Intronic
983119283 4:163860372-163860394 GATACTATGGTGGTACTAGCAGG + Intronic
987887791 5:23832748-23832770 GGTTTGATTGTGGTACAAGCTGG - Intergenic
993556795 5:89349414-89349436 GGTTCACTGGGGGTAGCAGCTGG + Intergenic
993751279 5:91671454-91671476 GGTTCTGTGGCAGTTCAAGCTGG - Intergenic
995995310 5:118291484-118291506 GGTTTTATTGTGGTACAAGGTGG + Intergenic
1001170891 5:169417956-169417978 GGTTCTATGTGGATCCAAACAGG + Intergenic
1004393360 6:15227597-15227619 GGTGCTTTGGGGGGACAAGCGGG + Intergenic
1013372831 6:109484681-109484703 GGATTTGTGGGGGTACAAGTGGG + Intergenic
1018729889 6:166640790-166640812 GGTTCAGTGGGGGGCCAAGCAGG + Intronic
1018957270 6:168418668-168418690 GGGTCCTTGGGGGTCCAAGCAGG - Intergenic
1035009826 7:155704767-155704789 TATTCTGTGGGTGTACAAGCAGG - Intronic
1038021904 8:23558023-23558045 GGTGCAATGGGGATACAAACAGG - Intronic
1047441535 8:124883272-124883294 GGCTCTATGTGGATAAAAGCTGG - Intergenic
1051762361 9:20481618-20481640 GGTACTATGGGGGTGGAAGTGGG - Intronic
1058369284 9:104246192-104246214 AGGTTTATGGGGGTAAAAGCTGG - Intergenic
1059138631 9:111831328-111831350 GGGTCCAGGGGGCTACAAGCAGG - Intergenic
1060728130 9:126019387-126019409 GGTTCTATGATGGTAGAAGTCGG + Intergenic
1192955007 X:76060285-76060307 GCTTATATGAGGGTACAAGATGG + Intergenic
1197890714 X:131267807-131267829 GGGTCAATGGGTATACAAGCTGG + Intergenic
1202242449 Y:22785646-22785668 GGTTCCATGTGGGTGCAGGCTGG + Intergenic
1202395434 Y:24419395-24419417 GGTTCCATGTGGGTGCAGGCTGG + Intergenic
1202475350 Y:25250697-25250719 GGTTCCATGTGGGTGCAGGCTGG - Intergenic