ID: 935413318

View in Genome Browser
Species Human (GRCh38)
Location 2:102788404-102788426
Sequence GTGTGCTCACCTGGTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935413313_935413318 1 Left 935413313 2:102788380-102788402 CCTTGGAGCTGGAGATTTGGCCC 0: 1
1: 0
2: 0
3: 19
4: 165
Right 935413318 2:102788404-102788426 GTGTGCTCACCTGGTCCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935413318 Original CRISPR GTGTGCTCACCTGGTCCCCT GGG Intronic