ID: 935413318

View in Genome Browser
Species Human (GRCh38)
Location 2:102788404-102788426
Sequence GTGTGCTCACCTGGTCCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 186
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 173}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935413313_935413318 1 Left 935413313 2:102788380-102788402 CCTTGGAGCTGGAGATTTGGCCC 0: 1
1: 0
2: 0
3: 19
4: 165
Right 935413318 2:102788404-102788426 GTGTGCTCACCTGGTCCCCTGGG 0: 1
1: 0
2: 0
3: 12
4: 173

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935413318 Original CRISPR GTGTGCTCACCTGGTCCCCT GGG Intronic
900437957 1:2640466-2640488 CTGTGCTCATCAGGGCCCCTCGG + Intronic
900558366 1:3291312-3291334 GTGGCCCCACCTGGACCCCTGGG + Intronic
901079235 1:6574521-6574543 GGGTGCTCTCCTGGTCTCCCCGG + Intronic
902368536 1:15992026-15992048 CTGTGCACATCTGGACCCCTGGG + Intergenic
904802346 1:33102587-33102609 CTGTTCTCACCTTGTCTCCTTGG + Intronic
907626510 1:56035565-56035587 GTGTGTCCACCTGGTCATCTGGG - Intergenic
915686568 1:157640146-157640168 GTGGGCTCACCTACTCCCCAGGG + Intergenic
916792378 1:168136247-168136269 GGCTGCTCACCTGGTCCTCACGG + Intronic
918154908 1:181835560-181835582 GTGGGCTCTCTTGGTCCCCAGGG + Intergenic
919701860 1:200639090-200639112 GGGTTCCCACCTGGCCCCCTGGG + Intronic
920308290 1:205032789-205032811 CCCTGCTCACCTGGTCCCCTGGG + Intergenic
921232580 1:213088089-213088111 GTGTGCTCACCTGTCAGCCTTGG + Intronic
923544672 1:234915343-234915365 GTGTCTTCACCTGCTCCCCTGGG + Intergenic
1065696720 10:28387431-28387453 ATGTGCTGACCTGGTCTACTGGG + Intergenic
1065778232 10:29142640-29142662 CTGTCCTCACCTGGGCCCGTGGG - Intergenic
1067561677 10:47308946-47308968 CTGTGCTGCCCTGGTGCCCTGGG + Intronic
1069942621 10:71965463-71965485 ATCTGCTCACCCGGTTCCCTTGG - Intronic
1070805765 10:79269861-79269883 GTACGCTCACCTGGGCACCTGGG - Intronic
1073533687 10:104255259-104255281 GGGTGCCCACCTGATTCCCTTGG - Exonic
1074230000 10:111524300-111524322 CTGTGGTCACCTAGTCACCTAGG + Intergenic
1074270846 10:111952072-111952094 GGGTGCTTTCCAGGTCCCCTGGG + Intergenic
1075444691 10:122505251-122505273 CAGTGCTCTCCTGGTCCTCTTGG + Intronic
1076666398 10:132095366-132095388 GTGGGCTCTCTTGGTTCCCTAGG - Intergenic
1076804907 10:132850488-132850510 GCGGGCTCACTGGGTCCCCTGGG - Intronic
1077774709 11:5258394-5258416 GTGGGCTCTCTGGGTCCCCTAGG + Intronic
1077885296 11:6382912-6382934 GTGTGCTCTCAGGGTCTCCTGGG + Intergenic
1079129480 11:17738921-17738943 GTGTCCTCAACTGTTCCCCGAGG - Intronic
1080034945 11:27700666-27700688 CTGTCCTCACCTCCTCCCCTAGG + Intronic
1080853393 11:36090889-36090911 GTCTGCTCAACAGGTCCTCTGGG - Intronic
1082160401 11:48883132-48883154 GTGTGGTCATCTGGTCCCAGAGG + Intergenic
1082161965 11:48897274-48897296 GTGTGGTCATCTGGTCCCAGAGG - Intergenic
1082167550 11:48965718-48965740 GTGTGGTCATCTGGTCCCAGAGG - Intergenic
1082236006 11:49820932-49820954 GTGTGGTCATCTGGTCCCAGAGG + Intergenic
1082239467 11:49855488-49855510 GTGTGGTCATCTGGTCCCAGAGG + Intergenic
1082242683 11:49888864-49888886 GTGTGGTCATCTGGTCCCAGAGG - Intergenic
1082609513 11:55280860-55280882 GTGTGGTCATCTGGTCCCAGAGG + Intergenic
1082657176 11:55869673-55869695 GTGTGGTCATCTGGTCCCAGAGG - Intergenic
1083334426 11:61914480-61914502 CTGTCCTCACCTCGTCACCTTGG + Intronic
1084400529 11:68940377-68940399 GCCGGCTCACCTGGTCCCCACGG - Exonic
1085510187 11:77084235-77084257 CTGGGCCCACCTGGGCCCCTGGG + Intronic
1088089486 11:106021813-106021835 GTGCGCGCCCCTGCTCCCCTGGG - Exonic
1091779156 12:3202960-3202982 GTGTGCTTCCCTGGTGCCTTTGG + Intronic
1092202902 12:6597877-6597899 GTGTGCTCAGCTGGTACCTGTGG + Exonic
1096037661 12:48486714-48486736 CTGTACTCACCTGGTCCCACAGG - Exonic
1098500521 12:71187042-71187064 GTGGGCTCTCCAGGTCCCCAGGG + Intronic
1100929986 12:99596884-99596906 GTATCCTCTCCTGGTCTCCTCGG - Intronic
1101866582 12:108524855-108524877 GAGGGCTCACCTGGGCACCTGGG - Intronic
1103194103 12:119027102-119027124 GTGCTCTCAGCTGCTCCCCTTGG - Intronic
1103782561 12:123408853-123408875 GTGTGCTCCCCTGCACACCTGGG - Exonic
1104118009 12:125768978-125769000 GTGGGCTTACCTGGTCTCCTCGG + Intergenic
1104960889 12:132488330-132488352 GAGTCCTCACCTGTTCCCCGAGG - Intergenic
1105690815 13:22837981-22838003 GTATGCTCTCTTGGGCCCCTTGG + Intergenic
1108525642 13:51283851-51283873 GTGTGCTCACATGCTCGCCTAGG + Intronic
1109168861 13:59071413-59071435 GTCTGCTTACCTTGTCCCCCAGG - Intergenic
1112086892 13:96041342-96041364 GTGGGCTCTCTGGGTCCCCTAGG + Intronic
1112187501 13:97141924-97141946 GTGTGATCACCTTTTCTCCTTGG + Intergenic
1116441725 14:44962182-44962204 GTTTGGTCACGTGGTGCCCTTGG + Intronic
1117545780 14:56794274-56794296 GTGTGCCCACCCGGGCACCTAGG - Intergenic
1119708516 14:76803776-76803798 ATGTGCTCACCTGATCTCTTGGG + Exonic
1122974815 14:105166740-105166762 GTGTGCCCACCTGGTATCCTGGG - Intronic
1124235234 15:27984324-27984346 GTGTGCATACTGGGTCCCCTGGG - Intronic
1124983579 15:34584419-34584441 GTGTGCTCCCCAGGGCCCCGCGG - Intronic
1128378865 15:67096783-67096805 GTCTGCTCACATTGTCTCCTGGG + Intronic
1132116775 15:99142794-99142816 GTGTGCTCACCATTTTCCCTGGG + Intronic
1132142312 15:99405990-99406012 GTGTGGTCTCCTTGTCCCCAAGG - Intergenic
1132575905 16:663925-663947 GTGTGGTCAGCTGGGCCCCACGG + Intronic
1137633727 16:49967398-49967420 CTGTGTTCAGCTTGTCCCCTGGG - Intergenic
1138247130 16:55476213-55476235 CTGTTCTCTCCTCGTCCCCTGGG + Intronic
1138531207 16:57635337-57635359 CCGTGTGCACCTGGTCCCCTAGG - Intronic
1138539410 16:57679360-57679382 GTGGGCACACCTGGGCCCATGGG + Intronic
1141164775 16:81653139-81653161 ATTTGCTCACCTGGCCCTCTGGG + Intronic
1144047254 17:11465175-11465197 GTGTCCTTTCCTGCTCCCCTCGG + Intronic
1145761334 17:27426796-27426818 CTGTGCACATCTGGACCCCTGGG + Intergenic
1145933097 17:28699967-28699989 TACTCCTCACCTGGTCCCCTAGG - Intronic
1146161386 17:30560952-30560974 CTGTGCACATCTGGACCCCTGGG + Intronic
1150142820 17:62744366-62744388 GGGTCCTTACCTGCTCCCCTGGG + Exonic
1151132000 17:71906984-71907006 GTGTGCTCACCAGACTCCCTAGG - Intergenic
1151619708 17:75238332-75238354 CTGTGCTCAGCTGCTCCCCCAGG + Exonic
1152963336 18:94150-94172 GTGTGCTTACCTTGTCCCTTGGG - Intergenic
1155158484 18:23177497-23177519 GTGTGGTCAGCTTGTCCACTTGG + Intronic
1157290353 18:46405604-46405626 GGATGCTGACCTGGGCCCCTGGG + Intronic
1160487001 18:79302398-79302420 GTGCTCTCACCTTGTCCCCGGGG - Intronic
1161138918 19:2636696-2636718 GTGTGCCCACAGGGGCCCCTAGG + Intronic
1161767657 19:6216199-6216221 GTGTCCTCTCCTGGTCCCTGAGG - Intronic
1162382687 19:10340749-10340771 GGGGTCCCACCTGGTCCCCTTGG - Intergenic
1162459443 19:10805811-10805833 GGCTGCTCACTTGGTCCCCAGGG + Intronic
1163634172 19:18430800-18430822 GTGTCCTGACCTGGCCCTCTGGG + Intronic
1163715044 19:18868530-18868552 GTCTGCTCCGCTGGTCTCCTTGG - Exonic
1165844492 19:38809504-38809526 GTGTTCTCACCCTGTCCCCCAGG + Intronic
1167436255 19:49480464-49480486 GCCTGCTCACCTGCTCCCCAGGG - Exonic
1168136426 19:54355360-54355382 GTATGCTCAGCTGGACCACTGGG - Exonic
1168158815 19:54494395-54494417 TTGTGCTCACATCATCCCCTTGG - Intergenic
1168172525 19:54597918-54597940 CTGTGCTCACCTGGTGGGCTTGG - Intronic
1168413625 19:56155474-56155496 GTCTGCTCACCTGGGGCCCTGGG - Intronic
927188610 2:20500312-20500334 GTCTGCTCACCTGTGCCCTTTGG - Intergenic
929651955 2:43688989-43689011 TTGTGTTCACCTGGGGCCCTGGG - Intronic
930843724 2:55878252-55878274 CTGTGCTCAACTGGTGACCTTGG + Intronic
932557878 2:72841683-72841705 CTGAGCTCACTGGGTCCCCTGGG + Intergenic
934296468 2:91746792-91746814 GTGTGCTCCCCTGCACACCTGGG + Intergenic
935413318 2:102788404-102788426 GTGTGCTCACCTGGTCCCCTGGG + Intronic
935709869 2:105888811-105888833 GTCTGCTCACATGAACCCCTAGG - Intronic
937073071 2:119079507-119079529 GTGTGCACACCTGCTCCATTGGG + Intergenic
937077494 2:119117692-119117714 GGGCGCTCACCTGGTCAGCTGGG + Intergenic
939219273 2:139281255-139281277 GTGGGCTCTCTTGGTCCCCAGGG + Intergenic
940962528 2:159801164-159801186 GTGTGCTCACCTGGCCAACTCGG + Intronic
941030417 2:160505091-160505113 GTGTGCTCCTCTGGATCCCTGGG + Intergenic
946547166 2:220756845-220756867 CTGTGCTCACCTGGGCTCCGTGG + Intergenic
947040764 2:225916934-225916956 GTTTGCTCCACTGGTGCCCTGGG - Intergenic
947611119 2:231525665-231525687 GTGTCCACACCTGGTCCAGTTGG - Intronic
1168762700 20:360261-360283 CTGAGCTAACCTAGTCCCCTGGG - Intergenic
1170881282 20:20298577-20298599 GTGTCCACACCTGGCCCCCATGG + Intronic
1171238570 20:23547328-23547350 GTGTGCACATCTGATACCCTGGG + Intergenic
1173295036 20:41748518-41748540 CTGTGTTCACCTGGAGCCCTGGG + Intergenic
1175363215 20:58431505-58431527 GTGGGCTCACCTGGGTCCCATGG - Intronic
1176927886 21:14772246-14772268 GTGTCTTCACCTGGTCTTCTGGG + Intergenic
1177338117 21:19760036-19760058 GCGTGCGCACCGGGTCCCCGGGG - Intergenic
1180617968 22:17141049-17141071 GTGTCCTCACCTGGGCATCTTGG + Exonic
1180865747 22:19118642-19118664 CTGTGCTCAGCTAGGCCCCTTGG - Intronic
1181931857 22:26408280-26408302 GTATTCTCCACTGGTCCCCTGGG - Intergenic
1183881522 22:40835793-40835815 GAGTTCTCACCTGGCCCTCTTGG + Exonic
1184503114 22:44885779-44885801 CTGGGCTCACCTGGTCCTGTGGG - Intronic
1184779402 22:46638968-46638990 GTGCGCTCACCTGGTGCTCAAGG + Intronic
950612402 3:14134722-14134744 AGGTTTTCACCTGGTCCCCTGGG + Intronic
953171419 3:40511192-40511214 GTGTGCCCATCTGTTCCTCTGGG - Intronic
953284393 3:41592318-41592340 GTGGGCTCTCTGGGTCCCCTGGG + Intronic
954961777 3:54571869-54571891 GTGTGCTCACCTTGCCCACAGGG + Intronic
962764485 3:138549051-138549073 GTGGGCTCTCTGGGTCCCCTGGG + Intronic
968577532 4:1374879-1374901 GGGTGCTCACATGGTCCTCAAGG - Intronic
968625878 4:1626491-1626513 GGGTCCTCCCCTGGTCCCCCCGG - Intronic
969608645 4:8215035-8215057 GTGTGCGCACCTGGTGCTCAGGG + Intronic
969901769 4:10356459-10356481 GTGGGCACTCCTGGTCCCCAGGG - Intergenic
974801900 4:66828613-66828635 GTGGGCTCACTTTGTCCCCAGGG - Intergenic
977991479 4:103447600-103447622 AAGTGCTCTCTTGGTCCCCTGGG - Intergenic
978999757 4:115201303-115201325 GGGAGCTCACAGGGTCCCCTAGG - Intergenic
985165773 4:187092551-187092573 GTGTGATCAGCTGGCCTCCTAGG + Intergenic
987189693 5:15463465-15463487 GTTTGTTCCACTGGTCCCCTGGG - Intergenic
988916189 5:35895575-35895597 GTGAGCTCAGCTGGCCCACTTGG - Intergenic
998848180 5:146331121-146331143 GTGTGTTCACCTGGTGGGCTAGG - Intronic
999285521 5:150392147-150392169 GTGGGCTGACTTGGCCCCCTGGG - Exonic
1002209965 5:177592663-177592685 GTTGGCTCACCTTGTCCTCTGGG - Exonic
1003547873 6:7075961-7075983 GTGTCCTCACCTGGCCCCTAGGG + Intergenic
1004417349 6:15436926-15436948 GAGTGCTCTCCTGGTCACATAGG + Intronic
1007295764 6:40819422-40819444 GGGAGCTCACATTGTCCCCTGGG - Intergenic
1007781887 6:44259112-44259134 ATGTGCTCTTCTGGTGCCCTAGG - Exonic
1009800288 6:68528166-68528188 GTGGGCTCTCTTGGTCCCCAGGG - Intergenic
1012330419 6:97978889-97978911 CTGTGCTCACCTAGGTCCCTGGG - Intergenic
1012565046 6:100638458-100638480 CTGTACTGATCTGGTCCCCTGGG + Intronic
1013221408 6:108080786-108080808 GTGGGCTCTCTGGGTCCCCTGGG - Intronic
1013633487 6:112007595-112007617 GTGTGCATACCTGGACCCCTTGG + Intergenic
1016407673 6:143747494-143747516 GTGTTATCACCTGCTCCCTTTGG + Intronic
1016569195 6:145493148-145493170 GTGTGCTCAGTTGGACACCTGGG + Intergenic
1018468924 6:164079646-164079668 GTGGGCTCAGGTGGTCCCCAAGG - Intergenic
1018744299 6:166750254-166750276 GTGTCCTCAGCTTCTCCCCTGGG + Intronic
1020119775 7:5496456-5496478 GTGGGCTCACCTGGATCCATAGG + Intronic
1020433847 7:8140975-8140997 CTGTGTTTACCTGGTCCCCCTGG - Intronic
1026880467 7:73904129-73904151 GTGGGCTCACCTGGGCCCAGAGG - Intergenic
1032436938 7:131908511-131908533 ATGTGCTCACCTTGCCCCTTGGG - Intergenic
1032544935 7:132734052-132734074 CTGTCCTCACCTGGGTCCCTAGG - Intergenic
1034432836 7:151049624-151049646 GTGGCCTCACATGCTCCCCTCGG - Intronic
1035205499 7:157291647-157291669 GTGTGTTCACCTGGGCGCCAGGG + Intergenic
1035715915 8:1754838-1754860 AGCTGCTCACCTGGTGCCCTGGG + Intergenic
1039810588 8:41044422-41044444 GTGGGCTCTCTGGGTCCCCTAGG - Intergenic
1040742980 8:50603728-50603750 GTGTGCTGACTTGGTGGCCTTGG + Intronic
1041012567 8:53558967-53558989 GTCTGCTCACCTAGTCACCTCGG - Intergenic
1041808007 8:61874937-61874959 ATGTGATCACCTGTTCCCATGGG + Intergenic
1045390172 8:101707375-101707397 GTGTGTTCATCTGGTGCCCGAGG + Intronic
1045581827 8:103489926-103489948 GTGGGCTCAGGTGGTCCTCTTGG - Intergenic
1045847832 8:106658173-106658195 GTGGGCTCACCAGGTCCCTCCGG - Intronic
1046252215 8:111646928-111646950 ATGTGTTCACCTGGTCACCCTGG - Intergenic
1048588900 8:135802850-135802872 GTCTCCTCACCTGCTTCCCTGGG - Intergenic
1049475407 8:142794895-142794917 GAGTGCTCAGCTGCACCCCTGGG - Intergenic
1049807838 8:144548885-144548907 CTGGGCTCACCTGGACCACTGGG - Intronic
1055942649 9:81665012-81665034 ATGTGGACACCAGGTCCCCTGGG + Intronic
1057177901 9:93012825-93012847 CTGTGCTCACCCAGCCCCCTGGG + Intronic
1059540637 9:115126925-115126947 GTGTGTTCACCTACTCCTCTCGG - Intergenic
1060283986 9:122232864-122232886 ATGTGGTCATCTGGTCCTCTGGG + Intergenic
1060418488 9:123450187-123450209 TTCTGCTCACTTGGTCCCCCAGG + Intronic
1060987268 9:127826870-127826892 GTGTGTTCATCTGGCCCCCCAGG - Intronic
1062571025 9:137185443-137185465 TTGTGCTCGCCTGGGCCCCCCGG - Intronic
1062734754 9:138129553-138129575 GTGTGCTTACCTTGTCCCTTGGG + Intergenic
1195232064 X:102859896-102859918 GTGGGCTCCCTGGGTCCCCTAGG - Intergenic
1197250266 X:124208872-124208894 GTGTGCTCACGTGGCCTCCTTGG + Intronic
1197363489 X:125536003-125536025 GTGGGCTCGCTGGGTCCCCTAGG + Intergenic
1197971969 X:132123721-132123743 GTTAGCTCACCTGATTCCCTTGG - Intronic
1197991442 X:132322479-132322501 GTGTGCTTACATGGTCCAGTCGG - Intergenic
1200073467 X:153540102-153540124 CTGTGCTCACCGGGTCCTGTCGG + Intronic