ID: 935414061

View in Genome Browser
Species Human (GRCh38)
Location 2:102796676-102796698
Sequence CAAGTGGCCAGCACTGGTAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 149}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935414052_935414061 29 Left 935414052 2:102796624-102796646 CCTGAATACAACTGCAGAATATT 0: 1
1: 0
2: 2
3: 32
4: 408
Right 935414061 2:102796676-102796698 CAAGTGGCCAGCACTGGTATGGG 0: 1
1: 0
2: 0
3: 16
4: 149
935414056_935414061 -9 Left 935414056 2:102796662-102796684 CCTGGAAACCATGCCAAGTGGCC 0: 1
1: 0
2: 0
3: 15
4: 131
Right 935414061 2:102796676-102796698 CAAGTGGCCAGCACTGGTATGGG 0: 1
1: 0
2: 0
3: 16
4: 149
935414055_935414061 -8 Left 935414055 2:102796661-102796683 CCCTGGAAACCATGCCAAGTGGC 0: 1
1: 0
2: 0
3: 17
4: 166
Right 935414061 2:102796676-102796698 CAAGTGGCCAGCACTGGTATGGG 0: 1
1: 0
2: 0
3: 16
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935414061 Original CRISPR CAAGTGGCCAGCACTGGTAT GGG Intronic
900776830 1:4592047-4592069 AAAGTGGCCAGGACTGGTTCTGG - Intergenic
901057965 1:6457673-6457695 CTATTGGCCAGCACTGGGCTGGG - Intronic
901130144 1:6957227-6957249 AATGTGGCCAGCACTGGGACTGG + Intronic
901674354 1:10874344-10874366 CAAGTGGCCAGTATTGGGCTGGG + Intergenic
901703195 1:11056303-11056325 GAAGTGGTCAGCACTGGAGTGGG - Intronic
902692637 1:18119486-18119508 CTACTGGACAGCACTGGTCTAGG + Intronic
906485156 1:46228904-46228926 CACGTGGCCTAGACTGGTATGGG + Intergenic
906891363 1:49719131-49719153 CAAGTGGCTATCACTGGAATAGG + Intronic
909028719 1:70513608-70513630 CAAGTGGCCATTACAGTTATAGG - Intergenic
919416959 1:197322630-197322652 CCATTAGACAGCACTGGTATAGG + Intronic
920804085 1:209216755-209216777 CAAGTGGTCTGCACTGGTGTTGG - Intergenic
924653212 1:245949073-245949095 CAAGTGGCCAGTGTTGGTGTTGG - Intronic
1062835353 10:632294-632316 CAAGCGGCCAGCACTGTAACTGG + Intronic
1063023908 10:2158492-2158514 CAAGTGTACAGCACAGGTATGGG - Intergenic
1064369747 10:14741065-14741087 CAAGCAGACAGCACTGGGATGGG + Intronic
1067527773 10:47048650-47048672 GAAGAGGCCAGCACTGGGTTGGG + Intergenic
1068162266 10:53279991-53280013 CAAGTAGCTAGCACAGGAATTGG + Intergenic
1068858778 10:61825111-61825133 CAGGTGGCCAGAACTCGTCTTGG - Intergenic
1078273640 11:9821438-9821460 AAAATGGCCAGTACTGATATGGG + Intronic
1078322671 11:10350798-10350820 CAAGTGCCCAGCACTGTTTTGGG - Intronic
1080717804 11:34820827-34820849 CAAGTCTCCAGCATTGGGATGGG - Intergenic
1081743689 11:45458286-45458308 GAATTGGCCAGCCCTGGGATGGG + Intergenic
1082774712 11:57236309-57236331 GAAGTGGCCAGCGATGGTTTGGG + Exonic
1082868498 11:57921040-57921062 CAAGTGGTCTGTACTGGTGTTGG - Intergenic
1084030424 11:66477686-66477708 CAGGTGGCCAGCACAGGTGTGGG - Intergenic
1086888344 11:92227168-92227190 CAAGTGGCCACGAGTGGTTTGGG - Intergenic
1088736491 11:112732034-112732056 CATGTGGCCATCAGTGGTATAGG + Intergenic
1092132139 12:6120095-6120117 CATGTGCCCAGCACTGGGCTAGG - Intronic
1093104129 12:15065708-15065730 CAAGTGGTCTGCACTGATGTTGG + Intergenic
1094498049 12:31001600-31001622 CAAGTGGCTAACACTGGTGCCGG - Intergenic
1095299429 12:40565419-40565441 CAGGTGGCCAGTACTGTAATTGG - Intronic
1095947893 12:47764239-47764261 AAAGTGGCCACAACTGGAATGGG - Intronic
1097818356 12:64100190-64100212 TAAGTGGCCAACCCAGGTATTGG - Intronic
1097903920 12:64900874-64900896 CATGTGGCCAGCACTGAGCTAGG - Intergenic
1099526627 12:83725099-83725121 CATGTGGCCATATCTGGTATTGG - Intergenic
1099537067 12:83857880-83857902 CAAGTGGTCTGCACTGTTGTTGG + Intergenic
1100026922 12:90141163-90141185 TAAGTGGCGTGCACTGGTGTTGG + Intergenic
1105970044 13:25420358-25420380 CAGGTGGCCAGGAGTGGTTTTGG + Intronic
1107774516 13:43823615-43823637 CAAGTTTCCATCACTGGGATGGG + Intergenic
1113109819 13:106811298-106811320 TAAGTGGTCTGCACTGTTATCGG - Intergenic
1114468913 14:22945278-22945300 CCAGTGGCCAGCTCAGTTATAGG - Intergenic
1114821653 14:26027570-26027592 TAAGTGCCCAGCATTGGTAATGG - Intergenic
1115537292 14:34385051-34385073 CAAGTGGCCAGAGCTGGGCTGGG - Intronic
1117293473 14:54356403-54356425 CAAGAGCCCAGCAGTGGTCTGGG + Intergenic
1117718711 14:58606980-58607002 CAAGGTGCCAGTACTGGTGTGGG + Intergenic
1118173283 14:63410829-63410851 AAAGTGGCAAGCAGGGGTATTGG - Intronic
1119503945 14:75155283-75155305 CCAGTGACCAGCACAGGTCTAGG - Intronic
1119569098 14:75654323-75654345 CTAGTGGCCAGCACTGGTTATGG + Intronic
1121463535 14:94100028-94100050 CAAGTGGGCAGCACAGGCCTAGG + Intronic
1127009798 15:54611103-54611125 CAAGTGGCCATCAGTAGTGTTGG + Intronic
1128377827 15:67089942-67089964 CCAGTGGCCAGCAGTAGTGTTGG + Intronic
1128973146 15:72126657-72126679 CTATTGGACAGCACTGCTATGGG + Intronic
1130693129 15:86103970-86103992 CAAGTGGCCTGTGCTGGTATTGG + Intergenic
1131296991 15:91157958-91157980 CAGGTGGGGAGCACTGGTTTTGG + Intronic
1131499994 15:92952930-92952952 CCAGTGGCCTGCAGTGGAATGGG + Intronic
1132263897 15:100449294-100449316 CAAGTGGTCTGCATTGGTGTTGG - Intronic
1137796024 16:51220903-51220925 CCAGTGGCCATCACTGGCATAGG + Intergenic
1139160850 16:64507199-64507221 CAAGTGGCCCACACTGGTGCTGG + Intergenic
1139407517 16:66730796-66730818 GAGCTGGCCAGCACTGGTGTAGG - Intronic
1141259482 16:82439834-82439856 CTAGTGCCCAGAGCTGGTATAGG - Intergenic
1142105734 16:88301684-88301706 CCTGTGGGCACCACTGGTATGGG + Intergenic
1143432662 17:6898526-6898548 CAGGTGGTGAGCACTGGTAGTGG + Intronic
1144901695 17:18599453-18599475 CAAGTGGCCCACATTGATATTGG - Intergenic
1144929377 17:18846607-18846629 CAAGTGGCCCACATTGATATTGG + Intronic
1148810793 17:50289855-50289877 CAGGTGGCCAACACTGGAGTGGG - Intergenic
1156690007 18:39696173-39696195 TATGTGGCCAGCACTGGCTTTGG - Intergenic
1156963392 18:43060468-43060490 CAAATGGTCAGCAATGGGATTGG + Intronic
1158788957 18:60751468-60751490 CAAGAGGCCTGCACTTTTATAGG - Intergenic
1159911456 18:74150302-74150324 CAAATGGACAGCACAGATATAGG - Intronic
1163096223 19:15059210-15059232 CAAGTGGCCAACACAGGGGTGGG + Intergenic
1167619668 19:50553748-50553770 CATGTGCCCAGCACTGTTGTGGG - Intronic
927155076 2:20216663-20216685 TCAGCGGCCACCACTGGTATTGG + Intronic
928227777 2:29468382-29468404 CAAGTGCTCAGCATTGGTCTAGG - Intronic
929619762 2:43342573-43342595 CAAGTGGCCAACACAGGTAGGGG - Intronic
930951147 2:57145703-57145725 CAAGTGATCTGCACTGGTGTTGG - Intergenic
931444528 2:62315706-62315728 GAAGTGGCCACCACCGGTGTTGG + Intergenic
935414061 2:102796676-102796698 CAAGTGGCCAGCACTGGTATGGG + Intronic
938792499 2:134689463-134689485 CTATTGGACAGCACTGGTCTAGG + Intronic
940811405 2:158246793-158246815 CTAGTGCACAGCACTGGTCTGGG - Intronic
944444585 2:199776502-199776524 AAAGTGGCCTGCACAAGTATGGG + Intronic
944604552 2:201339969-201339991 CAAGTGGTACTCACTGGTATTGG + Intronic
944941997 2:204638916-204638938 CAAGTATCCAGCCCTGGCATGGG + Intronic
945212383 2:207397328-207397350 GAAGTGGCCCGAACTGGTCTGGG + Intergenic
948498500 2:238371898-238371920 CTATTGGGCAGCATTGGTATAGG + Intronic
949010263 2:241674301-241674323 CCTGTGGGCAGCCCTGGTATAGG + Intergenic
1168744474 20:226542-226564 CCAGTGGCCAGCATGGGTATTGG - Intergenic
1169534663 20:6525342-6525364 CAAGCAGCCTGCACTGGTGTCGG + Intergenic
1172566723 20:35936329-35936351 TTAGTGGCTAGCAGTGGTATGGG + Intronic
1179430925 21:41320617-41320639 CCAGCCGCCAGCACTGGGATCGG - Intronic
1179584491 21:42365990-42366012 CAGGTGGCCATCACTGGGACCGG + Intronic
1179943114 21:44652393-44652415 CAAGTGGCCTGTGCTGGTACCGG - Intronic
1180698616 22:17769853-17769875 CACGTGACCAGGCCTGGTATTGG - Intronic
1182075114 22:27490273-27490295 CAAGTGGCCAGAGATGGTTTTGG + Intergenic
1182551135 22:31101241-31101263 CAGGTGGGCAGCACTGTGATGGG + Intronic
1182982961 22:34688981-34689003 CAATTGGCCAGCCCTGGGATGGG - Intergenic
953063080 3:39443859-39443881 CCAGAGGCCAGAACTGGAATGGG + Intergenic
953808061 3:46088854-46088876 CTATTGGACAGCACTGGTGTAGG + Intergenic
954986713 3:54800859-54800881 CAAGTGGCTAGCTCTGCTACAGG - Intronic
955424983 3:58778495-58778517 CAAGTGGTCCACACTGGTGTTGG - Intronic
957996575 3:87697719-87697741 CAAGTGGCCAGCTGAGCTATGGG + Intergenic
960736795 3:120790112-120790134 CTATTGGACAGCACTGGTCTAGG + Intergenic
961407753 3:126694079-126694101 CATGTGGCCAGCACTGGCCAGGG + Intergenic
962142006 3:132800226-132800248 CAACTGGACAGCACTGCTCTAGG + Intergenic
963168519 3:142228261-142228283 AAAATGGCCAGCACTGGTGAAGG - Intergenic
968278635 3:197459291-197459313 CATGTGGCCAGCACTGTTGGTGG - Intergenic
968664935 4:1815880-1815902 CAAGTGGTCAGCACTGACACAGG + Intronic
969630187 4:8331351-8331373 CAAGTGACCAGCACTGGGCCAGG - Intergenic
970438082 4:16055087-16055109 CAGGTGGACAGCACTGGGTTAGG - Intronic
970441746 4:16086010-16086032 CAAGTTTTCACCACTGGTATGGG - Intergenic
973246888 4:48018691-48018713 CATGTGCCAAGCACTGGCATAGG + Intronic
973608056 4:52607363-52607385 AAAGTGGGCAACAATGGTATAGG + Intronic
977660728 4:99582153-99582175 CCATTGGACAGCACTTGTATTGG + Intronic
978728355 4:111997113-111997135 TAAGTGGCCAGCAGTGGGCTAGG - Intergenic
981888128 4:149702900-149702922 CATGTTGACAGCACTGGTAAAGG + Intergenic
982537443 4:156624818-156624840 CAAGAGGCCAGCTCTGAGATGGG + Intergenic
985171054 4:187150593-187150615 CAGTGGGCCAGCAATGGTATTGG - Intergenic
985775123 5:1837447-1837469 CAAGTCACCAGCACTGGCAGTGG - Intergenic
987624369 5:20378446-20378468 CGAGGGTCCAGCACTGGTCTAGG + Intronic
988491113 5:31706392-31706414 GAAGGGGGCAGGACTGGTATGGG + Intronic
990078271 5:51878962-51878984 CAAGTGCCAAGCACTGGGAAAGG - Intergenic
991947789 5:71916448-71916470 CAAGTGGTCCACATTGGTATTGG - Intergenic
992157195 5:73967158-73967180 CAAGTGGCAAACACTGGTCATGG + Intergenic
992615024 5:78539246-78539268 CAAGGTGCCAGCAGTGGTGTCGG - Intronic
992640162 5:78762161-78762183 CAAAAGGCCAGCAGTGGAATGGG - Intronic
993888918 5:93448802-93448824 CAAGTGGCCCTCCCTGGTGTGGG - Intergenic
998462913 5:142322800-142322822 CATGTGGCCAGTACGGGTGTAGG - Intronic
1001674061 5:173497898-173497920 CAAGTGGCCGGCTGTGGGATGGG + Intergenic
1004060633 6:12194263-12194285 CCATTGGCCAGCACAGGTCTAGG + Intergenic
1005063779 6:21798453-21798475 CAAGTAGCCATCACTGCAATTGG + Intergenic
1006377004 6:33677169-33677191 CCAGTGGCCAGCACAGGGAGAGG - Intronic
1009940589 6:70283411-70283433 CTACTGGCCAGCACTGGCACAGG - Intronic
1011033114 6:82943955-82943977 CAAGTTCCCACCACTGGGATGGG - Intronic
1011696403 6:89917567-89917589 CAAGTGGTCTGCACTGGTGTTGG + Intergenic
1015365614 6:132393924-132393946 CAAGTGGTCAGTGCTGGTGTTGG - Intronic
1018201535 6:161399807-161399829 CAATTGGACAGCACTGTTCTAGG - Intronic
1019575646 7:1736365-1736387 CAAGAGGCCAGGGCTGGTGTGGG - Intronic
1020094516 7:5361157-5361179 GAAGGGGCCAGCCCTGGTCTCGG + Intronic
1020781647 7:12523662-12523684 CAAGTGGCCAACTCTGAGATAGG + Intergenic
1022870327 7:34471562-34471584 CAAGTGGTCCACACTGGTGTTGG + Intergenic
1023055369 7:36286064-36286086 CAGGTGGCCAACACTGGAACAGG - Intronic
1026109547 7:67448069-67448091 CAAGTGACCAGGAATGCTATTGG - Intergenic
1027127661 7:75568355-75568377 CATGTGGCCAGCACTGCCAGGGG + Intronic
1029790837 7:102841482-102841504 CAAGAAGCCAGGACTGGTGTGGG + Intronic
1032094144 7:128929258-128929280 CCAGGAGCCAGCACTGGGATTGG - Intergenic
1032784051 7:135186751-135186773 CCTGTGGCCAGCACTGTTCTGGG - Intronic
1032796713 7:135283294-135283316 CAGGTGTCCAGCACTGCCATGGG + Intergenic
1036803478 8:11810309-11810331 CAAGAGGCCAGCAGTGTTACAGG - Intronic
1037584515 8:20267443-20267465 CATGTGGCCAGCACAGTTGTAGG + Intronic
1042082649 8:65071795-65071817 CAAGTTTCCACCACTGGGATGGG + Intergenic
1043614406 8:82107887-82107909 CAAGTGGACAACACTAGTTTGGG - Intergenic
1043650043 8:82579409-82579431 CAAGTGGTCTGCACTGATGTGGG - Intergenic
1046899511 8:119508977-119508999 CAAGTGGCAAGCACTGTGATAGG + Intergenic
1046969076 8:120200972-120200994 TAAGTGTCAAGCACTGGGATAGG - Intronic
1056309097 9:85321541-85321563 CATGAGGCCAGCACTGGCCTGGG - Intergenic
1056729398 9:89152283-89152305 CAACTGGCCACCACTGGGAGAGG - Intronic
1057230819 9:93320312-93320334 CGAGTGGCCAGCACTGCGGTGGG + Intronic
1057666137 9:97046940-97046962 CAAGGGGGCAGCACTGGTGTGGG - Intergenic
1058124842 9:101179364-101179386 CAAGTGGTCATAGCTGGTATTGG - Intronic
1058544949 9:106051513-106051535 CACTTAGCCAGCACTGGTATCGG + Intergenic
1058613674 9:106802669-106802691 CTAGTGGCCAGCACAGTGATTGG - Intergenic
1059930834 9:119258864-119258886 CAAGTGGCCTTCACTGCTCTGGG - Intronic
1060461526 9:123859680-123859702 CAAATGGCTAGCATTTGTATAGG - Intronic
1186662022 X:11678056-11678078 CAGGTGCCCAGCCCTGGTAGAGG + Intergenic
1187096842 X:16157705-16157727 CATGTGCCCAGCACTGGACTTGG - Intergenic
1190537156 X:51440728-51440750 CAAGTTCCCACCACTGGGATGGG - Intergenic
1200058479 X:153473652-153473674 CAAGTGGTGAGCCCTGGCATTGG + Intronic