ID: 935418388

View in Genome Browser
Species Human (GRCh38)
Location 2:102842419-102842441
Sequence CCTGATAAGCAGCTGTGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 181
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 164}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935418388_935418392 13 Left 935418388 2:102842419-102842441 CCCTCACACAGCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 935418392 2:102842455-102842477 TTTCCTACCTCATTGGCTTCTGG 0: 1
1: 0
2: 0
3: 31
4: 302
935418388_935418391 6 Left 935418388 2:102842419-102842441 CCCTCACACAGCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 935418391 2:102842448-102842470 AGTTCAGTTTCCTACCTCATTGG 0: 1
1: 0
2: 1
3: 10
4: 163
935418388_935418397 27 Left 935418388 2:102842419-102842441 CCCTCACACAGCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 935418397 2:102842469-102842491 GGCTTCTGGGGAGCTTTCCCCGG 0: 1
1: 0
2: 2
3: 23
4: 207
935418388_935418394 15 Left 935418388 2:102842419-102842441 CCCTCACACAGCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 935418394 2:102842457-102842479 TCCTACCTCATTGGCTTCTGGGG 0: 1
1: 0
2: 2
3: 27
4: 250
935418388_935418393 14 Left 935418388 2:102842419-102842441 CCCTCACACAGCTGCTTATCAGG 0: 1
1: 0
2: 0
3: 16
4: 164
Right 935418393 2:102842456-102842478 TTCCTACCTCATTGGCTTCTGGG 0: 1
1: 0
2: 3
3: 27
4: 321

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935418388 Original CRISPR CCTGATAAGCAGCTGTGTGA GGG (reversed) Intronic
900171413 1:1270936-1270958 GCTGGGAAGCAGCTGTGAGAAGG - Intronic
901142579 1:7044548-7044570 CGTGATTAGCAGATGGGTGATGG + Intronic
901241552 1:7697093-7697115 CCTGCACAGCAGCTGTGTGAGGG - Intronic
903018951 1:20380140-20380162 GCTAATAAGCAGCAGGGTGAGGG - Intergenic
903499916 1:23795160-23795182 ACTGAGAAGCAGCTGAGTGGAGG - Exonic
904515946 1:31055225-31055247 CTTGATAGGCAGCTGTGCTAAGG - Intronic
905491932 1:38351133-38351155 CAAGAGAAGCTGCTGTGTGAAGG - Intergenic
908147999 1:61267825-61267847 CCTGATTAGGAGCTTTTTGAGGG + Intronic
908261585 1:62343370-62343392 CCTGATACACAGGGGTGTGATGG - Intergenic
911471751 1:98327741-98327763 CCAGATAAGGAGCTTTGTGGTGG + Intergenic
912401344 1:109396473-109396495 CCCGAGCAGCAGCTGTGTAAAGG - Intronic
912983107 1:114397195-114397217 CCTGATATGTATGTGTGTGAAGG + Exonic
914512131 1:148343496-148343518 CCTGATAAGCAGAGATGTTATGG + Intergenic
919200979 1:194355191-194355213 CCTGGGGAGCAGATGTGTGATGG + Intergenic
919636338 1:200006971-200006993 CCTGATAACCAGAGGTGTGTAGG - Intergenic
921735264 1:218620396-218620418 TCTGATAAGCAGCTGTGATGTGG + Intergenic
923250925 1:232179072-232179094 CCTGCTGGGCAGCTGTCTGATGG + Intergenic
1064680741 10:17808981-17809003 CCTGGGAAGCAGCTGAGTCAGGG - Intergenic
1065081742 10:22136223-22136245 CCTCCTAAGCAGCTGGGGGAAGG + Intergenic
1066808457 10:39290556-39290578 TCTGATAAACTGCTTTGTGATGG - Intergenic
1067665678 10:48275969-48275991 CCAGCTATGCAGCTGTGTAAAGG + Intergenic
1069883246 10:71607233-71607255 CCCATTAAGCAGCTGTGTGTGGG - Intronic
1072539424 10:96386952-96386974 GCCGATAAGAAGATGTGTGAAGG - Exonic
1074565972 10:114578208-114578230 CCTGATTTGTAGCTGTGTGCTGG + Intronic
1076716569 10:132367815-132367837 GCTGAAAAGCAGCAGTGAGAGGG - Intronic
1077535081 11:3120167-3120189 CCTGGACAGCAGCTGGGTGAGGG + Intronic
1077579702 11:3408857-3408879 TCTGAGAAGAAGCTGTGGGAAGG - Intergenic
1079631819 11:22686940-22686962 TCTTAAAAGCAGCTCTGTGAAGG + Intronic
1081113227 11:39162632-39162654 CTTGATAACCGGCTGTGTGATGG - Intergenic
1081489338 11:43555296-43555318 TCTGCCAAGCAGCTGTGAGAAGG + Intergenic
1083582377 11:63833061-63833083 CAGGAAAAGCAGGTGTGTGATGG + Intergenic
1084454093 11:69257415-69257437 TCTCATATGCAGCTGTGTGCTGG - Intergenic
1086812463 11:91327810-91327832 TCTGATGAGCAGCAGTGGGAGGG + Intergenic
1087906508 11:103703823-103703845 AGTGAGAAGCAGCAGTGTGATGG + Intergenic
1089243665 11:117102178-117102200 GCTGATTAGGAGCTGGGTGAAGG - Intergenic
1089391208 11:118103157-118103179 CCGAGGAAGCAGCTGTGTGACGG + Exonic
1090411448 11:126512511-126512533 CCTGAGGAGCAGCCGTATGAGGG + Intronic
1090420276 11:126570551-126570573 CGTGATCAGCAGGTGTGTGAGGG - Intronic
1091452428 12:581607-581629 CCTGAGCAGCAGCTCTGTGAAGG + Intronic
1091580914 12:1788586-1788608 CCAGAAAGGCATCTGTGTGATGG + Exonic
1091585842 12:1816179-1816201 CCTGCTAGCCAGCTGTGTGCAGG + Intronic
1092387971 12:8050771-8050793 CCTGCTAAGAAGGTGTGTGTCGG + Intronic
1095385477 12:41644994-41645016 CCTGAGAAGCAGGAGTGTGCAGG - Intergenic
1096719496 12:53510450-53510472 CCAGAGGAGCAGCGGTGTGAGGG + Intronic
1097119645 12:56721340-56721362 CCTGGTTAGCAGCTGAGAGAGGG + Exonic
1098066265 12:66620628-66620650 ACTGATCAGCAGCTTTGTAAAGG - Intronic
1098847060 12:75550725-75550747 CCTGCGAAGCAACTCTGTGAGGG + Intergenic
1103612565 12:122133093-122133115 GCTGCTAGCCAGCTGTGTGAGGG + Intronic
1103736020 12:123061332-123061354 CCTCATCAACAGCTCTGTGAGGG + Intronic
1106883048 13:34152662-34152684 CCTGATAAGGAGTTGTAGGAGGG - Intergenic
1107662759 13:42656369-42656391 CCTCTTAAGCAGCTGGGGGAGGG + Intergenic
1109878684 13:68441120-68441142 CCTCATAAGCAGAAGTGAGAAGG + Intergenic
1112694055 13:101927786-101927808 TCTGATCAGGAGCTGTGTGTTGG - Intronic
1115566718 14:34630561-34630583 CCTGATTACCGACTGTGTGAAGG - Intergenic
1117441407 14:55762840-55762862 CCTGAAAAGCAGATTCGTGAGGG + Intergenic
1118408211 14:65448343-65448365 CCTGATAAGCATGAGTTTGATGG - Intronic
1118819229 14:69334275-69334297 GCTGAGAAGCAAGTGTGTGAGGG - Intronic
1125323496 15:38512914-38512936 CCTTGTAAATAGCTGTGTGAAGG - Exonic
1127000824 15:54502577-54502599 CTTGATGAGCAGCTGTGTTTGGG + Intronic
1131540891 15:93274379-93274401 CCTGCTAACCAGCTGGGGGAGGG + Intergenic
1133008412 16:2897203-2897225 ACTGAACAGCAGCTGTGTGCAGG + Intronic
1135776745 16:25263168-25263190 CCTGACAAGCAGCTGGGAGCAGG - Intergenic
1140203408 16:72913140-72913162 CATTAGAGGCAGCTGTGTGAAGG - Intronic
1203142407 16_KI270728v1_random:1776883-1776905 CCTGAAGAGCAGGTGTGTGCAGG - Intergenic
1203142500 16_KI270728v1_random:1777508-1777530 CCTGGAAAGCAGGTGTGTGCAGG - Intergenic
1146647433 17:34584474-34584496 CCTCATAGGCTGCTGTGTGAGGG + Intronic
1147424455 17:40339357-40339379 CCTGAGAAGGAGCTGAGGGAGGG + Intronic
1149455650 17:56785954-56785976 CCTGACAAGCAGCTCTGGGTGGG + Intergenic
1150944097 17:69725351-69725373 CCCTATAAGCAGCTGTGGGTTGG - Intergenic
1152558957 17:81068391-81068413 CCTGCAGAGCAGCTGTCTGAGGG + Intronic
1152900191 17:82936759-82936781 CCTGATGAGCAGCTCTGAGAGGG - Intronic
1155236947 18:23829879-23829901 ATTTATAAGAAGCTGTGTGAAGG - Intronic
1161133822 19:2608002-2608024 CCTGAGACGCAGCTCTTTGAGGG + Intronic
1162345633 19:10116552-10116574 CCTGATGAGCTGCTGTCTGTCGG - Intronic
1163364826 19:16870000-16870022 CGGGAGAAGCTGCTGTGTGAGGG + Exonic
1164557613 19:29265789-29265811 CAGAATAAGCAGCTGTGTGTTGG - Intergenic
928838016 2:35570133-35570155 CATTATAAGAAGCTGTATGAAGG - Intergenic
930941525 2:57020004-57020026 TCTGATTGGCACCTGTGTGATGG - Intergenic
931257275 2:60584613-60584635 ACTGACAAGCAGCTGTTTGAAGG - Intergenic
931456134 2:62411180-62411202 CCTGCAAAGTAGCTGTGTCAGGG + Intergenic
931951169 2:67363781-67363803 CCTGATAGCAAGCTCTGTGAAGG + Intergenic
933947613 2:87300204-87300226 CCTGACAAGCAGCTGGCTGCAGG + Intergenic
935418388 2:102842419-102842441 CCTGATAAGCAGCTGTGTGAGGG - Intronic
935671007 2:105557200-105557222 CCTGAGAAGGAGCTGTGGGGTGG - Intergenic
936332583 2:111561373-111561395 CCTGACAAGCAGCTGGCTGCAGG - Intergenic
936348662 2:111695578-111695600 CCTCATAAACGGCTGGGTGATGG + Intergenic
937269336 2:120638066-120638088 CCTGTGAAGCAGATGTGTGCAGG - Intergenic
937873248 2:126801605-126801627 ACTGATATGCAGGTGGGTGAGGG - Intergenic
942289892 2:174458517-174458539 CTTGATTAGAAGCTGGGTGAGGG - Intronic
944303993 2:198157989-198158011 CCTTAAAAGCAGCTGGGTGTGGG + Intronic
948678131 2:239611084-239611106 TCTGAGAAGCAGCTGTCAGATGG - Intergenic
1170790627 20:19506333-19506355 CATGAGAAGCATCTCTGTGAAGG - Intronic
1171116894 20:22532549-22532571 TCTGAGAAGCAGCTGTGATATGG + Intergenic
1173579575 20:44137511-44137533 ACTGATAAGGAGCTCTGGGAAGG + Intronic
1173680932 20:44881243-44881265 CATGATAAACATCTGTGTGCAGG - Intergenic
1174196555 20:48776418-48776440 CCTGCTTAGCAGCTGTGGGAGGG + Intronic
1176230014 20:64027795-64027817 CCACACAAGCAGCTGGGTGACGG - Intronic
1177023208 21:15888706-15888728 CCTAATAAGCAGCAGTCAGAGGG + Intergenic
1178699635 21:34822031-34822053 CCAAATAAGCAGCAGAGTGAGGG + Intronic
1178931438 21:36822031-36822053 GCTCATTAGCAGCTGTGGGAGGG - Intronic
1179804847 21:43830706-43830728 CCTGAAGGGCAGCTGTGTGAAGG - Intergenic
1179918481 21:44493877-44493899 CCCGACAAGCAGCTTTGTGTCGG + Intergenic
1181823857 22:25497362-25497384 CATGATAAACAGCAGTGAGAGGG + Intergenic
1182230471 22:28834043-28834065 CCTGCCAAAGAGCTGTGTGAAGG + Intergenic
1183148179 22:36014833-36014855 CCTGATAAGCGCCTCTCTGAAGG + Intronic
1185263529 22:49884944-49884966 CCTGAGAAGCAGCAGGCTGATGG + Exonic
952811016 3:37402727-37402749 CCTGATAAGCAGCTATTGCAAGG - Intronic
955393612 3:58538745-58538767 CCTTAGAAGAAGCTGAGTGAAGG - Intergenic
956326720 3:68060906-68060928 CCTGACAAGCTGGTTTGTGATGG - Intronic
957176936 3:76823880-76823902 CCTGATTAGCAGTTGTTTTATGG + Intronic
957907046 3:86570407-86570429 CCAGATAAGCCGCTGGGTGTGGG - Intergenic
958203604 3:90357715-90357737 CCTGAGAAGCTTCTTTGTGATGG - Intergenic
959460631 3:106621741-106621763 CCTGATAACCTGCTCTGAGAAGG + Intergenic
959556225 3:107721923-107721945 TCTGATAAGCAGCTTTATGTTGG + Intronic
959626750 3:108461196-108461218 CCTGAGTAGCAACTGTGCGATGG + Intronic
961907764 3:130280297-130280319 CCCCATAAGCAGCTGTGGGATGG - Intergenic
961918426 3:130401056-130401078 CATGATGAGCAGTTGTGTTAAGG - Exonic
963086994 3:141446394-141446416 CGTGGTAATAAGCTGTGTGACGG + Exonic
963316471 3:143764273-143764295 CCTGAGAAGCAGATGGGTGGGGG - Intronic
966556939 3:181272976-181272998 TCTTATAAGCATCTGTTTGAAGG + Intergenic
967232473 3:187353257-187353279 CCTGGGTAGCAGCTGTGTGGCGG - Intergenic
967507436 3:190268889-190268911 CCTTATATTCAGCTGTGGGATGG + Intergenic
972473867 4:39432594-39432616 CCTGATAAGAAACTTTCTGAGGG + Intronic
978961768 4:114688181-114688203 CATGCTAACCAGCTGCGTGAAGG - Intergenic
979182037 4:117742139-117742161 CCAGCTAGACAGCTGTGTGAGGG + Intergenic
985701657 5:1377122-1377144 CATGAGAAGCAGCTGTGTGCTGG - Intergenic
986265362 5:6185765-6185787 CCTGAAGAGCAGGTGTGTGGTGG + Intergenic
986265366 5:6185794-6185816 CCTGAAGAGCAGGTGTGTGGTGG + Intergenic
986265374 5:6185852-6185874 CCTGAAGAGCAGGTGTGTGGTGG + Intergenic
987215890 5:15736788-15736810 CTTGATACGCTGCTGTCTGATGG + Intronic
987290536 5:16504483-16504505 CCAGGTAGGCAGCGGTGTGATGG - Intronic
989848417 5:46176023-46176045 TCTGAGAATCAGCTTTGTGATGG - Intergenic
996755041 5:126926717-126926739 GTTGATAAGCAGCTGGGTGGTGG - Intronic
997231778 5:132250767-132250789 CCTGAGAAGTAGCTGTGTGTAGG - Intronic
1000589030 5:163135979-163136001 TCTGATAAACAGCTGTGGGGTGG + Intergenic
1001002975 5:168024985-168025007 CCTGATAAGCACCTGGATGCTGG - Intronic
1001957748 5:175859866-175859888 CCTGATAAGAAGTTTTCTGAAGG + Intronic
1002495004 5:179605798-179605820 CCTGAGAGCCAGCTGTGTTAGGG + Intronic
1004798325 6:19115191-19115213 CCTAGCCAGCAGCTGTGTGATGG - Intergenic
1006327449 6:33365095-33365117 ACTGAGAAGCAGCTGAGTGGAGG + Intergenic
1009063734 6:58430416-58430438 TCTGAGAAGCTGCTTTGTGATGG - Intergenic
1009064645 6:58444552-58444574 TCTGAAAAGCAGCTTTGTGATGG + Intergenic
1009251402 6:61305002-61305024 TCTGAGAAGCTGCTTTGTGATGG - Intergenic
1009835118 6:68990518-68990540 CCTTCTAAGCAGCTGTCAGATGG + Intronic
1010568404 6:77447356-77447378 AGTGATATGCAGCTGTGGGAGGG - Intergenic
1014211176 6:118709781-118709803 CCTGATAAGCAGCCCTGTCAGGG - Intronic
1014624057 6:123704373-123704395 CCTAGTAAGCATCTGTGTCAGGG + Intergenic
1015032968 6:128618089-128618111 CCTGACAAGGAACTGTGTGTAGG + Intergenic
1016454206 6:144214714-144214736 CCTGTAAAGTAGGTGTGTGAGGG - Intergenic
1017718640 6:157229433-157229455 CCTGACAAGCTGTTGTGTGGTGG - Intergenic
1019002722 6:168768971-168768993 CTTGAGAAGCAGATTTGTGAGGG + Intergenic
1024345675 7:48310699-48310721 TCTGACAAGCAGCAGTGTGAGGG + Intronic
1028481649 7:91313240-91313262 CCTGTTCAGCAGCTGTCAGAAGG + Intergenic
1030322517 7:108183955-108183977 TCTGTTAGGCAGCTGTATGATGG - Intronic
1031071431 7:117166558-117166580 CCTTTTAAGCAGGAGTGTGATGG + Intronic
1034147832 7:148888006-148888028 CCTGAGAATCAGCTATGTGCCGG - Intergenic
1034593089 7:152160498-152160520 TCTGAGAAGCAGGTGTGTGGCGG + Intronic
1035275502 7:157745840-157745862 CCAGAGAAGGAGCTTTGTGATGG - Intronic
1036716123 8:11125609-11125631 CCTAATAAACAGCCGTGCGAAGG + Intronic
1040327284 8:46356573-46356595 GCTGAGAAACAGCTTTGTGATGG - Intergenic
1040328235 8:46372733-46372755 CCTGTTAAACTGCTTTGTGATGG - Intergenic
1045943378 8:107765535-107765557 CAGGAAAAGCAGCTGTTTGAAGG + Intergenic
1048236739 8:132698382-132698404 CCTGAGAAGCAGCTTTGCAAGGG - Intronic
1048748839 8:137647899-137647921 CATGATAAGTATCTGTGTAATGG - Intergenic
1049474418 8:142790162-142790184 CCTGGTAAGCAGGTGGGTGTCGG + Intergenic
1049835576 8:144733536-144733558 CCAGTCAAGCAGCTGTGTGTAGG - Intronic
1050671278 9:8000110-8000132 CCAGCAAAGCAGCTGTGTAATGG + Intergenic
1055840793 9:80500687-80500709 CATGCTAAGCAGCTTTGTGGAGG - Intergenic
1056214847 9:84397457-84397479 CCTGCTAAGCAGCTCTTAGATGG - Intergenic
1056788133 9:89606894-89606916 TCAGATAAGCAGCTGTAGGAGGG - Intergenic
1056872201 9:90292317-90292339 CCTGAGAACCAGCTGAGTGCAGG - Intergenic
1057504837 9:95625640-95625662 TGTGAGAAGCAGCTATGTGACGG + Intergenic
1058286283 9:103183744-103183766 CCTGCCAGGCAGCTGTGTGTGGG - Intergenic
1059493591 9:114690658-114690680 CCTCCTAAGAAGCTGTGGGAGGG + Intergenic
1060052967 9:120390200-120390222 TCTGGGAAGCAGCTGTGGGAAGG + Intronic
1060333426 9:122697884-122697906 CGTGATAAGCATATGTGTGCAGG - Intergenic
1061232609 9:129323529-129323551 TCTCTTAAGCAACTGTGTGAGGG - Intergenic
1185796325 X:2968148-2968170 CCTGACATGCAGCTGTGTAAGGG + Intronic
1187150677 X:16679001-16679023 CAAGATAAGCACGTGTGTGATGG + Intronic
1195247124 X:103004873-103004895 ACTGAGAAGCAGCTGTGCTAGGG + Intergenic
1201274461 Y:12285203-12285225 CCTGGTGAGCAGCTGTGGAAGGG + Intergenic