ID: 935419186

View in Genome Browser
Species Human (GRCh38)
Location 2:102849022-102849044
Sequence TCCAAGACTTTCCTGACATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935419186_935419187 13 Left 935419186 2:102849022-102849044 CCAAATGTCAGGAAAGTCTTGGA No data
Right 935419187 2:102849058-102849080 TCTTTCCGACACTGCCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935419186 Original CRISPR TCCAAGACTTTCCTGACATT TGG (reversed) Intergenic
No off target data available for this crispr