ID: 935419488

View in Genome Browser
Species Human (GRCh38)
Location 2:102852766-102852788
Sequence TAATCTTGCCAGAGGGCAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935419483_935419488 13 Left 935419483 2:102852730-102852752 CCAGTTAGTCACTGGAGAAGCCA No data
Right 935419488 2:102852766-102852788 TAATCTTGCCAGAGGGCAGTTGG No data
935419480_935419488 22 Left 935419480 2:102852721-102852743 CCTTCCTGTCCAGTTAGTCACTG No data
Right 935419488 2:102852766-102852788 TAATCTTGCCAGAGGGCAGTTGG No data
935419482_935419488 18 Left 935419482 2:102852725-102852747 CCTGTCCAGTTAGTCACTGGAGA No data
Right 935419488 2:102852766-102852788 TAATCTTGCCAGAGGGCAGTTGG No data
935419484_935419488 -7 Left 935419484 2:102852750-102852772 CCAAGCTCCATAGATATAATCTT No data
Right 935419488 2:102852766-102852788 TAATCTTGCCAGAGGGCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935419488 Original CRISPR TAATCTTGCCAGAGGGCAGT TGG Intergenic
No off target data available for this crispr