ID: 935423182

View in Genome Browser
Species Human (GRCh38)
Location 2:102891967-102891989
Sequence GGGAATGAGTATATGGATAT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935423180_935423182 -7 Left 935423180 2:102891951-102891973 CCACTGCAAGAAGTAAGGGAATG No data
Right 935423182 2:102891967-102891989 GGGAATGAGTATATGGATATAGG No data
935423179_935423182 -6 Left 935423179 2:102891950-102891972 CCCACTGCAAGAAGTAAGGGAAT No data
Right 935423182 2:102891967-102891989 GGGAATGAGTATATGGATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935423182 Original CRISPR GGGAATGAGTATATGGATAT AGG Intergenic
No off target data available for this crispr