ID: 935425111

View in Genome Browser
Species Human (GRCh38)
Location 2:102911329-102911351
Sequence TCCTTTTGAGATACAGCTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935425111_935425114 5 Left 935425111 2:102911329-102911351 CCAAGAGCTGTATCTCAAAAGGA No data
Right 935425114 2:102911357-102911379 GTTATTTGCAGAAGATGGCAGGG No data
935425111_935425115 27 Left 935425111 2:102911329-102911351 CCAAGAGCTGTATCTCAAAAGGA No data
Right 935425115 2:102911379-102911401 GCCTTGCTCCAAAATTCTAGAGG 0: 6
1: 157
2: 208
3: 151
4: 275
935425111_935425112 0 Left 935425111 2:102911329-102911351 CCAAGAGCTGTATCTCAAAAGGA No data
Right 935425112 2:102911352-102911374 GAGTAGTTATTTGCAGAAGATGG 0: 11
1: 189
2: 190
3: 139
4: 322
935425111_935425113 4 Left 935425111 2:102911329-102911351 CCAAGAGCTGTATCTCAAAAGGA No data
Right 935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935425111 Original CRISPR TCCTTTTGAGATACAGCTCT TGG (reversed) Intergenic
No off target data available for this crispr