ID: 935425113

View in Genome Browser
Species Human (GRCh38)
Location 2:102911356-102911378
Sequence AGTTATTTGCAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935425106_935425113 25 Left 935425106 2:102911308-102911330 CCACCAAAGCCCAGTAACAGGCC 0: 144
1: 161
2: 86
3: 68
4: 218
Right 935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG No data
935425111_935425113 4 Left 935425111 2:102911329-102911351 CCAAGAGCTGTATCTCAAAAGGA No data
Right 935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG No data
935425107_935425113 22 Left 935425107 2:102911311-102911333 CCAAAGCCCAGTAACAGGCCAAG 0: 169
1: 171
2: 103
3: 76
4: 232
Right 935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG No data
935425109_935425113 15 Left 935425109 2:102911318-102911340 CCAGTAACAGGCCAAGAGCTGTA No data
Right 935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG No data
935425108_935425113 16 Left 935425108 2:102911317-102911339 CCCAGTAACAGGCCAAGAGCTGT 0: 174
1: 194
2: 145
3: 123
4: 215
Right 935425113 2:102911356-102911378 AGTTATTTGCAGAAGATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935425113 Original CRISPR AGTTATTTGCAGAAGATGGC AGG Intergenic
No off target data available for this crispr