ID: 935426980

View in Genome Browser
Species Human (GRCh38)
Location 2:102929892-102929914
Sequence CGTTCTAGGCAGAAGGGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935426980_935426989 20 Left 935426980 2:102929892-102929914 CCTCCCCCCTTCTGCCTAGAACG No data
Right 935426989 2:102929935-102929957 CCTCCTCATTTTCCTCCCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935426980 Original CRISPR CGTTCTAGGCAGAAGGGGGG AGG (reversed) Intergenic
No off target data available for this crispr