ID: 935432819

View in Genome Browser
Species Human (GRCh38)
Location 2:102994709-102994731
Sequence ATGAATAAACAGTCTGGTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935432819_935432821 -5 Left 935432819 2:102994709-102994731 CCAGAACCAGACTGTTTATTCAT No data
Right 935432821 2:102994727-102994749 TTCATCCATTTACCTGCTGAAGG No data
935432819_935432822 -4 Left 935432819 2:102994709-102994731 CCAGAACCAGACTGTTTATTCAT No data
Right 935432822 2:102994728-102994750 TCATCCATTTACCTGCTGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935432819 Original CRISPR ATGAATAAACAGTCTGGTTC TGG (reversed) Intergenic
No off target data available for this crispr