ID: 935432819 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:102994709-102994731 |
| Sequence | ATGAATAAACAGTCTGGTTC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 935432819_935432821 | -5 | Left | 935432819 | 2:102994709-102994731 | CCAGAACCAGACTGTTTATTCAT | No data | ||
| Right | 935432821 | 2:102994727-102994749 | TTCATCCATTTACCTGCTGAAGG | No data | ||||
| 935432819_935432822 | -4 | Left | 935432819 | 2:102994709-102994731 | CCAGAACCAGACTGTTTATTCAT | No data | ||
| Right | 935432822 | 2:102994728-102994750 | TCATCCATTTACCTGCTGAAGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 935432819 | Original CRISPR | ATGAATAAACAGTCTGGTTC TGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||