ID: 935433370

View in Genome Browser
Species Human (GRCh38)
Location 2:103002276-103002298
Sequence CTGTATGTGAATAAGGAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935433364_935433370 23 Left 935433364 2:103002230-103002252 CCATATTTATCTGAAACTCATTT No data
Right 935433370 2:103002276-103002298 CTGTATGTGAATAAGGAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935433370 Original CRISPR CTGTATGTGAATAAGGAGGG TGG Intergenic
No off target data available for this crispr