ID: 935437954

View in Genome Browser
Species Human (GRCh38)
Location 2:103056898-103056920
Sequence AGGGAGAGTGCCGTGACTAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935437954_935437970 24 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437970 2:103056945-103056967 GCTGCATGGGGAGAGGGAAGGGG No data
935437954_935437965 17 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437965 2:103056938-103056960 TATCCAAGCTGCATGGGGAGAGG No data
935437954_935437968 22 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437968 2:103056943-103056965 AAGCTGCATGGGGAGAGGGAAGG No data
935437954_935437971 27 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437971 2:103056948-103056970 GCATGGGGAGAGGGAAGGGGTGG No data
935437954_935437964 12 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437964 2:103056933-103056955 CAGACTATCCAAGCTGCATGGGG No data
935437954_935437966 18 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437966 2:103056939-103056961 ATCCAAGCTGCATGGGGAGAGGG No data
935437954_935437963 11 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437963 2:103056932-103056954 ACAGACTATCCAAGCTGCATGGG No data
935437954_935437969 23 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437969 2:103056944-103056966 AGCTGCATGGGGAGAGGGAAGGG No data
935437954_935437962 10 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437962 2:103056931-103056953 TACAGACTATCCAAGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935437954 Original CRISPR AGGGAGAGTGCCGTGACTAG GGG (reversed) Intergenic
No off target data available for this crispr