ID: 935437962

View in Genome Browser
Species Human (GRCh38)
Location 2:103056931-103056953
Sequence TACAGACTATCCAAGCTGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935437955_935437962 9 Left 935437955 2:103056899-103056921 CCCTAGTCACGGCACTCTCCCTC No data
Right 935437962 2:103056931-103056953 TACAGACTATCCAAGCTGCATGG No data
935437957_935437962 -9 Left 935437957 2:103056917-103056939 CCCTCCCCAAAGTGTACAGACTA No data
Right 935437962 2:103056931-103056953 TACAGACTATCCAAGCTGCATGG No data
935437958_935437962 -10 Left 935437958 2:103056918-103056940 CCTCCCCAAAGTGTACAGACTAT No data
Right 935437962 2:103056931-103056953 TACAGACTATCCAAGCTGCATGG No data
935437956_935437962 8 Left 935437956 2:103056900-103056922 CCTAGTCACGGCACTCTCCCTCC No data
Right 935437962 2:103056931-103056953 TACAGACTATCCAAGCTGCATGG No data
935437954_935437962 10 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437962 2:103056931-103056953 TACAGACTATCCAAGCTGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935437962 Original CRISPR TACAGACTATCCAAGCTGCA TGG Intergenic
No off target data available for this crispr