ID: 935437969

View in Genome Browser
Species Human (GRCh38)
Location 2:103056944-103056966
Sequence AGCTGCATGGGGAGAGGGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935437957_935437969 4 Left 935437957 2:103056917-103056939 CCCTCCCCAAAGTGTACAGACTA No data
Right 935437969 2:103056944-103056966 AGCTGCATGGGGAGAGGGAAGGG No data
935437959_935437969 0 Left 935437959 2:103056921-103056943 CCCCAAAGTGTACAGACTATCCA No data
Right 935437969 2:103056944-103056966 AGCTGCATGGGGAGAGGGAAGGG No data
935437954_935437969 23 Left 935437954 2:103056898-103056920 CCCCTAGTCACGGCACTCTCCCT No data
Right 935437969 2:103056944-103056966 AGCTGCATGGGGAGAGGGAAGGG No data
935437961_935437969 -2 Left 935437961 2:103056923-103056945 CCAAAGTGTACAGACTATCCAAG No data
Right 935437969 2:103056944-103056966 AGCTGCATGGGGAGAGGGAAGGG No data
935437955_935437969 22 Left 935437955 2:103056899-103056921 CCCTAGTCACGGCACTCTCCCTC No data
Right 935437969 2:103056944-103056966 AGCTGCATGGGGAGAGGGAAGGG No data
935437958_935437969 3 Left 935437958 2:103056918-103056940 CCTCCCCAAAGTGTACAGACTAT No data
Right 935437969 2:103056944-103056966 AGCTGCATGGGGAGAGGGAAGGG No data
935437960_935437969 -1 Left 935437960 2:103056922-103056944 CCCAAAGTGTACAGACTATCCAA No data
Right 935437969 2:103056944-103056966 AGCTGCATGGGGAGAGGGAAGGG No data
935437956_935437969 21 Left 935437956 2:103056900-103056922 CCTAGTCACGGCACTCTCCCTCC No data
Right 935437969 2:103056944-103056966 AGCTGCATGGGGAGAGGGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935437969 Original CRISPR AGCTGCATGGGGAGAGGGAA GGG Intergenic
No off target data available for this crispr