ID: 935444314 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:103140056-103140078 |
| Sequence | CAGGAGGCAAGGGCTGCTGA TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 641 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 55, 4: 583} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 935444314_935444321 | 26 | Left | 935444314 | 2:103140056-103140078 | CCATCAGCAGCCCTTGCCTCCTG | 0: 1 1: 0 2: 2 3: 55 4: 583 |
||
| Right | 935444321 | 2:103140105-103140127 | TCCTGCAGAGTCCCCGTAATAGG | No data | ||||
| 935444314_935444319 | -4 | Left | 935444314 | 2:103140056-103140078 | CCATCAGCAGCCCTTGCCTCCTG | 0: 1 1: 0 2: 2 3: 55 4: 583 |
||
| Right | 935444319 | 2:103140075-103140097 | CCTGCAGCTGTTCTGATTAATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 935444314 | Original CRISPR | CAGGAGGCAAGGGCTGCTGA TGG (reversed) | Intergenic | ||