ID: 935444314

View in Genome Browser
Species Human (GRCh38)
Location 2:103140056-103140078
Sequence CAGGAGGCAAGGGCTGCTGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 641
Summary {0: 1, 1: 0, 2: 2, 3: 55, 4: 583}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935444314_935444319 -4 Left 935444314 2:103140056-103140078 CCATCAGCAGCCCTTGCCTCCTG 0: 1
1: 0
2: 2
3: 55
4: 583
Right 935444319 2:103140075-103140097 CCTGCAGCTGTTCTGATTAATGG No data
935444314_935444321 26 Left 935444314 2:103140056-103140078 CCATCAGCAGCCCTTGCCTCCTG 0: 1
1: 0
2: 2
3: 55
4: 583
Right 935444321 2:103140105-103140127 TCCTGCAGAGTCCCCGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935444314 Original CRISPR CAGGAGGCAAGGGCTGCTGA TGG (reversed) Intergenic