ID: 935444315

View in Genome Browser
Species Human (GRCh38)
Location 2:103140066-103140088
Sequence AGAACAGCTGCAGGAGGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935444315_935444321 16 Left 935444315 2:103140066-103140088 CCCTTGCCTCCTGCAGCTGTTCT No data
Right 935444321 2:103140105-103140127 TCCTGCAGAGTCCCCGTAATAGG No data
935444315_935444323 23 Left 935444315 2:103140066-103140088 CCCTTGCCTCCTGCAGCTGTTCT No data
Right 935444323 2:103140112-103140134 GAGTCCCCGTAATAGGTGTCAGG No data
935444315_935444325 27 Left 935444315 2:103140066-103140088 CCCTTGCCTCCTGCAGCTGTTCT No data
Right 935444325 2:103140116-103140138 CCCCGTAATAGGTGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935444315 Original CRISPR AGAACAGCTGCAGGAGGCAA GGG (reversed) Intergenic