ID: 935444317

View in Genome Browser
Species Human (GRCh38)
Location 2:103140072-103140094
Sequence TTAATCAGAACAGCTGCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935444317_935444321 10 Left 935444317 2:103140072-103140094 CCTCCTGCAGCTGTTCTGATTAA No data
Right 935444321 2:103140105-103140127 TCCTGCAGAGTCCCCGTAATAGG No data
935444317_935444325 21 Left 935444317 2:103140072-103140094 CCTCCTGCAGCTGTTCTGATTAA No data
Right 935444325 2:103140116-103140138 CCCCGTAATAGGTGTCAGGAAGG No data
935444317_935444323 17 Left 935444317 2:103140072-103140094 CCTCCTGCAGCTGTTCTGATTAA No data
Right 935444323 2:103140112-103140134 GAGTCCCCGTAATAGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935444317 Original CRISPR TTAATCAGAACAGCTGCAGG AGG (reversed) Intergenic
No off target data available for this crispr