ID: 935444321

View in Genome Browser
Species Human (GRCh38)
Location 2:103140105-103140127
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935444315_935444321 16 Left 935444315 2:103140066-103140088 CCCTTGCCTCCTGCAGCTGTTCT No data
Right 935444321 2:103140105-103140127 TCCTGCAGAGTCCCCGTAATAGG No data
935444316_935444321 15 Left 935444316 2:103140067-103140089 CCTTGCCTCCTGCAGCTGTTCTG No data
Right 935444321 2:103140105-103140127 TCCTGCAGAGTCCCCGTAATAGG No data
935444317_935444321 10 Left 935444317 2:103140072-103140094 CCTCCTGCAGCTGTTCTGATTAA No data
Right 935444321 2:103140105-103140127 TCCTGCAGAGTCCCCGTAATAGG No data
935444314_935444321 26 Left 935444314 2:103140056-103140078 CCATCAGCAGCCCTTGCCTCCTG No data
Right 935444321 2:103140105-103140127 TCCTGCAGAGTCCCCGTAATAGG No data
935444318_935444321 7 Left 935444318 2:103140075-103140097 CCTGCAGCTGTTCTGATTAATGG No data
Right 935444321 2:103140105-103140127 TCCTGCAGAGTCCCCGTAATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type