ID: 935444323

View in Genome Browser
Species Human (GRCh38)
Location 2:103140112-103140134
Sequence GAGTCCCCGTAATAGGTGTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935444316_935444323 22 Left 935444316 2:103140067-103140089 CCTTGCCTCCTGCAGCTGTTCTG No data
Right 935444323 2:103140112-103140134 GAGTCCCCGTAATAGGTGTCAGG No data
935444318_935444323 14 Left 935444318 2:103140075-103140097 CCTGCAGCTGTTCTGATTAATGG No data
Right 935444323 2:103140112-103140134 GAGTCCCCGTAATAGGTGTCAGG No data
935444317_935444323 17 Left 935444317 2:103140072-103140094 CCTCCTGCAGCTGTTCTGATTAA No data
Right 935444323 2:103140112-103140134 GAGTCCCCGTAATAGGTGTCAGG No data
935444315_935444323 23 Left 935444315 2:103140066-103140088 CCCTTGCCTCCTGCAGCTGTTCT No data
Right 935444323 2:103140112-103140134 GAGTCCCCGTAATAGGTGTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935444323 Original CRISPR GAGTCCCCGTAATAGGTGTC AGG Intergenic