ID: 935444325

View in Genome Browser
Species Human (GRCh38)
Location 2:103140116-103140138
Sequence CCCCGTAATAGGTGTCAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935444320_935444325 -10 Left 935444320 2:103140103-103140125 CCTCCTGCAGAGTCCCCGTAATA No data
Right 935444325 2:103140116-103140138 CCCCGTAATAGGTGTCAGGAAGG No data
935444318_935444325 18 Left 935444318 2:103140075-103140097 CCTGCAGCTGTTCTGATTAATGG No data
Right 935444325 2:103140116-103140138 CCCCGTAATAGGTGTCAGGAAGG No data
935444317_935444325 21 Left 935444317 2:103140072-103140094 CCTCCTGCAGCTGTTCTGATTAA No data
Right 935444325 2:103140116-103140138 CCCCGTAATAGGTGTCAGGAAGG No data
935444316_935444325 26 Left 935444316 2:103140067-103140089 CCTTGCCTCCTGCAGCTGTTCTG No data
Right 935444325 2:103140116-103140138 CCCCGTAATAGGTGTCAGGAAGG No data
935444315_935444325 27 Left 935444315 2:103140066-103140088 CCCTTGCCTCCTGCAGCTGTTCT No data
Right 935444325 2:103140116-103140138 CCCCGTAATAGGTGTCAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935444325 Original CRISPR CCCCGTAATAGGTGTCAGGA AGG Intergenic