ID: 935446145

View in Genome Browser
Species Human (GRCh38)
Location 2:103158829-103158851
Sequence CTTCTACCTTCCCCTAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935446145_935446149 28 Left 935446145 2:103158829-103158851 CCTGCCTTAGGGGAAGGTAGAAG No data
Right 935446149 2:103158880-103158902 TTGTAAGAGCCCTTGATATATGG No data
935446145_935446151 30 Left 935446145 2:103158829-103158851 CCTGCCTTAGGGGAAGGTAGAAG No data
Right 935446151 2:103158882-103158904 GTAAGAGCCCTTGATATATGGGG No data
935446145_935446150 29 Left 935446145 2:103158829-103158851 CCTGCCTTAGGGGAAGGTAGAAG No data
Right 935446150 2:103158881-103158903 TGTAAGAGCCCTTGATATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935446145 Original CRISPR CTTCTACCTTCCCCTAAGGC AGG (reversed) Intergenic
No off target data available for this crispr