ID: 935447436

View in Genome Browser
Species Human (GRCh38)
Location 2:103171618-103171640
Sequence TCTAAAAAACACACTCTTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935447436_935447438 -10 Left 935447436 2:103171618-103171640 CCTTAAAGAGTGTGTTTTTTAGA No data
Right 935447438 2:103171631-103171653 GTTTTTTAGATTTTCCCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935447436 Original CRISPR TCTAAAAAACACACTCTTTA AGG (reversed) Intergenic
No off target data available for this crispr