ID: 935449526

View in Genome Browser
Species Human (GRCh38)
Location 2:103192635-103192657
Sequence AATATAAAACAGAATGAAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935449523_935449526 20 Left 935449523 2:103192592-103192614 CCATAGGCTCAAAGTAAAGAAAT 0: 3
1: 44
2: 217
3: 445
4: 730
Right 935449526 2:103192635-103192657 AATATAAAACAGAATGAAGAAGG No data
935449522_935449526 21 Left 935449522 2:103192591-103192613 CCCATAGGCTCAAAGTAAAGAAA No data
Right 935449526 2:103192635-103192657 AATATAAAACAGAATGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935449526 Original CRISPR AATATAAAACAGAATGAAGA AGG Intergenic
No off target data available for this crispr