ID: 935451094

View in Genome Browser
Species Human (GRCh38)
Location 2:103210400-103210422
Sequence TTTTGACTTCTTCTTAAGGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935451091_935451094 20 Left 935451091 2:103210357-103210379 CCTTTGGTCAGAGGACTTTTGTG No data
Right 935451094 2:103210400-103210422 TTTTGACTTCTTCTTAAGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935451094 Original CRISPR TTTTGACTTCTTCTTAAGGG TGG Intergenic
No off target data available for this crispr