ID: 935452793

View in Genome Browser
Species Human (GRCh38)
Location 2:103229652-103229674
Sequence ATATTCAATGGGCTGTGCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935452793_935452797 3 Left 935452793 2:103229652-103229674 CCTTTGCACAGCCCATTGAATAT No data
Right 935452797 2:103229678-103229700 GAATGTTGAATGCTAATACTAGG No data
935452793_935452798 22 Left 935452793 2:103229652-103229674 CCTTTGCACAGCCCATTGAATAT No data
Right 935452798 2:103229697-103229719 TAGGAATATTTCCACAACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935452793 Original CRISPR ATATTCAATGGGCTGTGCAA AGG (reversed) Intergenic
No off target data available for this crispr