ID: 935457772

View in Genome Browser
Species Human (GRCh38)
Location 2:103290028-103290050
Sequence CAGAAATACCTCTTTTAAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
935457772_935457775 22 Left 935457772 2:103290028-103290050 CCTACTTAAAAGAGGTATTTCTG No data
Right 935457775 2:103290073-103290095 GAATTATTTTTTCCACAGGAAGG No data
935457772_935457774 18 Left 935457772 2:103290028-103290050 CCTACTTAAAAGAGGTATTTCTG No data
Right 935457774 2:103290069-103290091 GCTTGAATTATTTTTTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
935457772 Original CRISPR CAGAAATACCTCTTTTAAGT AGG (reversed) Intergenic
No off target data available for this crispr